ID: 1044573326

View in Genome Browser
Species Human (GRCh38)
Location 8:93743320-93743342
Sequence CTGTGTGAATAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044573326_1044573331 22 Left 1044573326 8:93743320-93743342 CCATCCTCCTTCTATTCACACAG No data
Right 1044573331 8:93743365-93743387 TATTGAATGTCTCTCCATTTTGG No data
1044573326_1044573329 -7 Left 1044573326 8:93743320-93743342 CCATCCTCCTTCTATTCACACAG No data
Right 1044573329 8:93743336-93743358 CACACAGTCTTTCTCCAGCGAGG No data
1044573326_1044573332 23 Left 1044573326 8:93743320-93743342 CCATCCTCCTTCTATTCACACAG No data
Right 1044573332 8:93743366-93743388 ATTGAATGTCTCTCCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044573326 Original CRISPR CTGTGTGAATAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr