ID: 1044577684 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:93788797-93788819 |
| Sequence | AAACTTAACTACAGGACAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044577679_1044577684 | 12 | Left | 1044577679 | 8:93788762-93788784 | CCAAATAGGTTTCCCACTACTTC | 0: 1 1: 0 2: 1 3: 5 4: 78 |
||
| Right | 1044577684 | 8:93788797-93788819 | AAACTTAACTACAGGACAGAAGG | No data | ||||
| 1044577681_1044577684 | -1 | Left | 1044577681 | 8:93788775-93788797 | CCACTACTTCACCAACTAAATTA | 0: 1 1: 0 2: 3 3: 33 4: 237 |
||
| Right | 1044577684 | 8:93788797-93788819 | AAACTTAACTACAGGACAGAAGG | No data | ||||
| 1044577680_1044577684 | 0 | Left | 1044577680 | 8:93788774-93788796 | CCCACTACTTCACCAACTAAATT | 0: 1 1: 0 2: 0 3: 23 4: 208 |
||
| Right | 1044577684 | 8:93788797-93788819 | AAACTTAACTACAGGACAGAAGG | No data | ||||
| 1044577678_1044577684 | 19 | Left | 1044577678 | 8:93788755-93788777 | CCTGCAGCCAAATAGGTTTCCCA | 0: 1 1: 0 2: 0 3: 12 4: 117 |
||
| Right | 1044577684 | 8:93788797-93788819 | AAACTTAACTACAGGACAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044577684 | Original CRISPR | AAACTTAACTACAGGACAGA AGG | Intronic | ||
| No off target data available for this crispr | |||||