ID: 1044577684

View in Genome Browser
Species Human (GRCh38)
Location 8:93788797-93788819
Sequence AAACTTAACTACAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044577679_1044577684 12 Left 1044577679 8:93788762-93788784 CCAAATAGGTTTCCCACTACTTC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1044577684 8:93788797-93788819 AAACTTAACTACAGGACAGAAGG No data
1044577681_1044577684 -1 Left 1044577681 8:93788775-93788797 CCACTACTTCACCAACTAAATTA 0: 1
1: 0
2: 3
3: 33
4: 237
Right 1044577684 8:93788797-93788819 AAACTTAACTACAGGACAGAAGG No data
1044577680_1044577684 0 Left 1044577680 8:93788774-93788796 CCCACTACTTCACCAACTAAATT 0: 1
1: 0
2: 0
3: 23
4: 208
Right 1044577684 8:93788797-93788819 AAACTTAACTACAGGACAGAAGG No data
1044577678_1044577684 19 Left 1044577678 8:93788755-93788777 CCTGCAGCCAAATAGGTTTCCCA 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1044577684 8:93788797-93788819 AAACTTAACTACAGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044577684 Original CRISPR AAACTTAACTACAGGACAGA AGG Intronic
No off target data available for this crispr