ID: 1044580007

View in Genome Browser
Species Human (GRCh38)
Location 8:93815758-93815780
Sequence TAACGTCTGGAGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044580007_1044580012 0 Left 1044580007 8:93815758-93815780 CCATCCACCCTCTCCAGACGTTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1044580012 8:93815781-93815803 AGTAACAAAAAAACAAGCACTGG No data
1044580007_1044580014 15 Left 1044580007 8:93815758-93815780 CCATCCACCCTCTCCAGACGTTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1044580014 8:93815796-93815818 AGCACTGGAGAGCTAGCTCAGGG No data
1044580007_1044580013 14 Left 1044580007 8:93815758-93815780 CCATCCACCCTCTCCAGACGTTA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1044580013 8:93815795-93815817 AAGCACTGGAGAGCTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044580007 Original CRISPR TAACGTCTGGAGAGGGTGGA TGG (reversed) Intronic
901013962 1:6217218-6217240 GAACGGCTGGAGAGGCTGGCAGG - Intronic
901375318 1:8834190-8834212 TTACCTCTGGGGAGGGTGGCAGG + Intergenic
901801597 1:11711449-11711471 TAACCTCTGCAGAGAGAGGAAGG + Intronic
902804076 1:18850067-18850089 TAAGGTCTGGGGAGGTAGGAAGG - Intronic
902992963 1:20202426-20202448 TTACGTCAGGATAGGGTGGTTGG + Intergenic
903547708 1:24137034-24137056 TCCCCTCTGGAGTGGGTGGAGGG - Intronic
906963244 1:50432235-50432257 GAGCTTCTGGAGAGGGTGGTAGG - Intergenic
909246608 1:73293341-73293363 TAGCATCTGGAGGGGGTAGATGG - Intergenic
911694572 1:100875292-100875314 TATAGTCTAGAGAGGGTAGAGGG + Intronic
912655061 1:111478548-111478570 TGACCTCTGGAGAAGGTGGCAGG - Intergenic
913181952 1:116330737-116330759 TGAGCTCTGGAGAGGGTGGGAGG + Intergenic
915147710 1:153805124-153805146 TAAAGCCTGGAGAGGGTACAGGG - Exonic
915269949 1:154746900-154746922 TAACATCTGGAGTAGGTGCATGG + Intronic
917171060 1:172175097-172175119 TAAAGTCAGGAGAGGGTATATGG - Intronic
918974453 1:191463962-191463984 TATTGTCGGGGGAGGGTGGAAGG + Intergenic
920043204 1:203117176-203117198 TAACTTCTGGACGTGGTGGATGG + Intronic
920215750 1:204360415-204360437 TAACATTTGGAGAGGGTTGGGGG + Intronic
920300116 1:204983377-204983399 TAACGTGTGGAGAGAGTTGGAGG + Intronic
921485995 1:215716175-215716197 GAACATCTGGAAAGAGTGGAAGG + Intronic
922348196 1:224714647-224714669 TAATGTCTGTTGAGTGTGGATGG + Intronic
923728300 1:236526344-236526366 GAACGTCTGGGTAGAGTGGAGGG + Intronic
1062772792 10:116496-116518 CAACAGCTTGAGAGGGTGGAGGG - Intergenic
1064963282 10:20989814-20989836 TGACGTCTGCAGAGGTTGGGGGG + Intronic
1072639572 10:97201820-97201842 TAACGGCTGCAGAAGGTGGCAGG - Intronic
1073686169 10:105756212-105756234 TAACTTGTGGAGATGGTGGTGGG - Intergenic
1076988082 11:253723-253745 CGAGGTCTGGAGAGGGTGGGTGG - Intergenic
1079448600 11:20579830-20579852 TAAGGGCAGGAGAGGATGGATGG + Intergenic
1080121410 11:28682065-28682087 TGACTCCTGGACAGGGTGGAGGG + Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081841551 11:46205323-46205345 TAATGTCTGGAGAATGAGGAGGG + Intergenic
1084039005 11:66530875-66530897 GAACCTATGGAGAGGGTGGGTGG - Exonic
1087590266 11:100178199-100178221 TAACGTTTGGAGAGGCATGATGG - Intronic
1087949062 11:104197740-104197762 TAATGTGTGGGGAGGGTGGGAGG - Intergenic
1088002794 11:104902791-104902813 GAACTTCTGGAAAGGGTTGAGGG + Intergenic
1089180662 11:116580957-116580979 TACCGTCTGGAGCGGGCGGCCGG - Intergenic
1090827610 11:130398773-130398795 GAGCGCCTTGAGAGGGTGGAGGG + Intergenic
1092463557 12:8707596-8707618 TAACCTCTGGAGACGGGAGACGG - Intronic
1095850473 12:46798311-46798333 TAAGGTGAGGAGAGTGTGGACGG - Intronic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1097265241 12:57740555-57740577 TTAGCTCTGGAGAGGGAGGAGGG - Intronic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102787301 12:115615015-115615037 TAAAGACTGGAGAGAGGGGAGGG + Intergenic
1103176613 12:118869458-118869480 TAACCTCTGGAGAGGGGAGAGGG + Intergenic
1105070131 12:133229403-133229425 AAAAGTCTGGAGAGGGGGGATGG - Intronic
1108152042 13:47546207-47546229 AAAAGTCAGAAGAGGGTGGATGG - Intergenic
1108495177 13:51017967-51017989 AAATGTATGGAGTGGGTGGAAGG - Intergenic
1111701275 13:91693112-91693134 TAATGTCTGGAGCAGATGGACGG + Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1119133226 14:72193662-72193684 TAAAGTTTGGTGATGGTGGAAGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1121962042 14:98269898-98269920 TAAGCTATGGAGAGGGTAGAAGG + Intergenic
1122180802 14:99953240-99953262 TAACCTGGGGAGAAGGTGGAGGG - Intergenic
1202855928 14_GL000225v1_random:52372-52394 AACCGGCTAGAGAGGGTGGAGGG - Intergenic
1129895684 15:79104210-79104232 TAACGTCAGCAGAGGATGCAGGG - Intergenic
1132663685 16:1072469-1072491 GAGAGTCTGAAGAGGGTGGAGGG - Intergenic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1137338646 16:47575692-47575714 TGGAGCCTGGAGAGGGTGGAAGG + Intronic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1142977862 17:3656191-3656213 TAAGGACTGGCGGGGGTGGAGGG - Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1149866160 17:60152123-60152145 TAACCTCTGGTCAGGGTGGATGG + Intronic
1150754215 17:67896376-67896398 AAACATTTGGAGAGGGTGGGAGG + Intronic
1153841857 18:9014917-9014939 GAACCTCTGGAGAGGCTGCATGG - Intergenic
1155170823 18:23265763-23265785 TCCCCACTGGAGAGGGTGGATGG + Intronic
1156494297 18:37515848-37515870 GAAAGGCTGGAGTGGGTGGAGGG + Intronic
1157488609 18:48107167-48107189 AACCGTCAGGAGAGGGAGGAAGG + Intronic
1159590060 18:70324591-70324613 AAACATCTGGAGAGGCTGCAAGG - Exonic
1160281867 18:77498758-77498780 TAAAGTCTGCAGAGGGAGCATGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1162021733 19:7871171-7871193 TAGCGCCTGCAGAGGGTGTATGG + Exonic
1162552123 19:11363857-11363879 TCCCGGCTGGAGAGGGTGGTGGG + Intronic
1165898983 19:39159844-39159866 CAGCGTCTGTGGAGGGTGGAGGG - Intronic
926762451 2:16290958-16290980 TAACATCTGGGGAGGGAAGAGGG - Intergenic
928272272 2:29867045-29867067 CAACTTCTGGGGTGGGTGGAAGG + Intronic
930034260 2:47075782-47075804 TAAAGCCTGGAGAGGGTAGGAGG + Exonic
932054321 2:68429508-68429530 CAACCTCTGGAGAGGGGAGAAGG + Intergenic
933750331 2:85599056-85599078 TAAGGTCTGGGGAGGGTGGCTGG - Exonic
933979634 2:87539417-87539439 TAGGGACTGAAGAGGGTGGAGGG + Intergenic
935640700 2:105287259-105287281 AAAGGTCTGGAGATGGTGGGTGG + Intronic
936314186 2:111411374-111411396 TAGGGACTGAAGAGGGTGGAGGG - Intergenic
942371886 2:175294304-175294326 TGACGTCTGGGGAGGGAAGAGGG - Intergenic
942572691 2:177329768-177329790 CAACTTCTAGAGAGGGTAGAGGG - Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1178375900 21:32067375-32067397 TCACGTCTGGGAAAGGTGGAAGG - Intergenic
1178901857 21:36605094-36605116 AAACGTGTGGGGTGGGTGGAAGG - Intergenic
1179418697 21:41218612-41218634 TAACCTATGGAGAGGTTGGTGGG + Intronic
1179995748 21:44973361-44973383 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1179995762 21:44973404-44973426 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1179995776 21:44973447-44973469 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1179995803 21:44973533-44973555 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1179995830 21:44973619-44973641 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1179995844 21:44973662-44973684 GAACCCCTGGAGAGGGTGGGCGG - Intronic
1180084692 21:45502721-45502743 TCACCCTTGGAGAGGGTGGAGGG + Intronic
1181067255 22:20312757-20312779 TAAAGTCTGGAGAGTGTAGATGG + Intergenic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
950185487 3:10942772-10942794 TAACGGCTTGAGATGGTGCAGGG - Intergenic
950677577 3:14563984-14564006 GCAGGTCTGGTGAGGGTGGAGGG - Intergenic
950904247 3:16523313-16523335 TGAAGTCTGGGCAGGGTGGAGGG - Intergenic
954091494 3:48287906-48287928 TAACAGCTGGAGAGTGAGGAAGG + Intronic
955470667 3:59282998-59283020 GAAACTCTGGAGGGGGTGGAGGG + Intergenic
957173078 3:76765064-76765086 TAGAGACTGCAGAGGGTGGAAGG - Intronic
957883850 3:86256989-86257011 CAAAGACTGGAGAAGGTGGAAGG + Intergenic
961065609 3:123872866-123872888 TAACATCTGGGGAGGGGAGAAGG - Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
963888241 3:150604056-150604078 TGACAGCTGGAGGGGGTGGAAGG + Intronic
965916171 3:173848951-173848973 TAAGGTATGTAGAGGGTGAAGGG + Intronic
969221269 4:5760397-5760419 TAACATCAGGAGAGGGTGACAGG + Intronic
970237414 4:13972765-13972787 TGACCTCTGGAGAGGGAAGATGG - Intergenic
971756779 4:30717788-30717810 TATGGTCTGGAGAGGGAAGAGGG + Intergenic
971851125 4:31987454-31987476 TAACCTCTGAAGAGGGTGTGGGG + Intergenic
971886142 4:32450694-32450716 TAATGGCTGTAAAGGGTGGATGG - Intergenic
974744058 4:66046849-66046871 TAAGGTCTGGAGAAAGTGGTAGG + Intergenic
976399126 4:84587734-84587756 TAACGTGTGGGGTGGGAGGAGGG + Intronic
977488365 4:97678766-97678788 TAGGGTCGGGGGAGGGTGGAGGG - Intronic
978987996 4:115039349-115039371 TAAAATCTGTAGAGGCTGGAGGG + Intronic
988647195 5:33107668-33107690 AAAGGTCAGGAGAGTGTGGAGGG + Intergenic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
989381140 5:40810545-40810567 CAACCTCTGGAGAGGGGAGAGGG - Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
994392856 5:99206375-99206397 TAACATCTGGGGAGGGGGGAAGG - Intergenic
994577908 5:101604385-101604407 TAACATCTGGGGAGGGGTGAAGG + Intergenic
994647557 5:102490075-102490097 TAGAGGCTGGAGAGGGTGGAAGG + Intronic
997785151 5:136703890-136703912 TCAATTCAGGAGAGGGTGGAAGG - Intergenic
1000498686 5:162020377-162020399 TAAAGTTTAGAGAGGGTAGAAGG + Intergenic
1000652533 5:163834559-163834581 TAACCTCTGCAGAGGATTGATGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1003831222 6:10014143-10014165 TGATGTCTGCAGGGGGTGGAGGG - Intronic
1007235871 6:40391250-40391272 TTACGTGTGGGGAGGGAGGAGGG - Intergenic
1008883766 6:56410128-56410150 TACCTTCTGGAGACTGTGGAAGG - Intergenic
1015768278 6:136742477-136742499 TAATTTCTGCAGAGGGTGTAAGG - Intronic
1017018101 6:150117393-150117415 GAGCGTCTTGACAGGGTGGAGGG - Intergenic
1018785809 6:167107039-167107061 TAATGTGTGGGGATGGTGGAGGG + Intergenic
1020121623 7:5507310-5507332 TCCTGTCTGGAGAGGGTGAAAGG - Intronic
1022198149 7:28089522-28089544 TAACGCGTAGAGAGGCTGGAAGG + Intronic
1028826777 7:95282596-95282618 CAGCCTCTGGGGAGGGTGGAGGG - Intronic
1031145074 7:117988693-117988715 TAATAGTTGGAGAGGGTGGAGGG + Intergenic
1031573610 7:123388866-123388888 CAACCTCTGGAGTGAGTGGATGG + Intergenic
1031641919 7:124175027-124175049 CAACTTCTGGAGAGGGTAGGAGG - Intergenic
1035913332 8:3593342-3593364 TAGAGTCTGGAGAAGGTGGGAGG + Intronic
1037188486 8:16093421-16093443 TAATGAGTGGAGAGGCTGGAAGG - Intergenic
1037441718 8:18923039-18923061 TAACCTCTGGGGAGGGGAGAGGG - Intronic
1042701568 8:71621140-71621162 AAATGTCTGGAGGGGGTGGGTGG - Intergenic
1043535095 8:81194368-81194390 TTACATCTGGAGAGGGTCCAGGG - Intergenic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1045429293 8:102098262-102098284 GAAGGACTGCAGAGGGTGGAGGG + Intronic
1048870491 8:138793271-138793293 TAGCGTCTAGAGAGGGTAGAAGG - Intronic
1049429549 8:142553556-142553578 GAAAGGCTGGAGAGTGTGGAGGG - Intergenic
1049555191 8:143278101-143278123 CATGGTCTGGAGAGGGTGGCGGG - Intergenic
1049655143 8:143793939-143793961 TACCGTCTGGAGCAGCTGGAGGG - Exonic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1056618267 9:88187424-88187446 TAGAGTCTGGAGAGGGAGGCTGG - Intergenic
1056722880 9:89086652-89086674 TAATCTCTGGAGAGGGGAGAAGG - Intronic
1057528123 9:95820328-95820350 TGACGTGAGGAGAGGGAGGACGG + Intergenic
1058745950 9:107990926-107990948 TAAGGTTTTGAGAGGATGGAAGG + Intergenic
1059096141 9:111416844-111416866 CAAGGCCTGGAGGGGGTGGATGG + Intronic
1060820627 9:126659475-126659497 GAATGTGTGGAGAGGCTGGATGG - Intronic
1062081946 9:134628831-134628853 TACCGTGTGGAGTGGGTTGAAGG - Intergenic
1195405786 X:104511774-104511796 AAACTGCTGGAGAGGATGGATGG - Intergenic
1196745836 X:119071011-119071033 TAGTGTCTGGTGAGGGTGGTGGG + Intergenic
1196897367 X:120350497-120350519 TAACTTCTGGGGAGGGCGTAGGG - Intergenic
1196980715 X:121210177-121210199 CAGCTTCTGGAGAGGCTGGAGGG - Intergenic
1197770186 X:130084636-130084658 TAAGGTCTTGAAGGGGTGGAGGG + Intronic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1198847041 X:140923376-140923398 TAAGGTTTGTAGAGGGAGGAAGG + Intergenic