ID: 1044585788

View in Genome Browser
Species Human (GRCh38)
Location 8:93868324-93868346
Sequence TTGGACAGCCAACACCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044585788 Original CRISPR TTGGACAGCCAACACCATTT TGG (reversed) Intronic
905640822 1:39588637-39588659 TTGCACATCCTACCCCATTTTGG + Intergenic
909329700 1:74396569-74396591 AAGGACAGCCATGACCATTTGGG + Intronic
910642055 1:89473813-89473835 TTGGAGAGCCCAAACCAATTGGG + Intergenic
911336580 1:96588461-96588483 TTGGACTTCCAACAACATTTTGG + Intergenic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
911650335 1:100380916-100380938 TTGTCCAGCCACCACCCTTTAGG + Intronic
916693070 1:167209620-167209642 TTGGACAGCCACTAGCTTTTTGG - Intergenic
918534607 1:185560266-185560288 TTGTACAGAAAATACCATTTTGG + Intergenic
1063078232 10:2738289-2738311 TTGGAGAGGCAACAGCATTGAGG - Intergenic
1066623136 10:37379451-37379473 GTGGGCAGCCATCACCATTGAGG + Intronic
1067250209 10:44579895-44579917 TTGGATAGGCAATACCATTCAGG - Intergenic
1069583745 10:69582928-69582950 TTGGAAAGCCAACCCAATGTAGG + Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1083646418 11:64173876-64173898 TTGGACCCCCAACCCCAGTTGGG - Intergenic
1089724853 11:120467392-120467414 TTGGAAATCCAACTCCATTCAGG - Intronic
1090118420 11:123999226-123999248 TAGGACAGGCAATACTATTTTGG + Intergenic
1092150045 12:6241705-6241727 GTGGACAGCCAGCTCCTTTTGGG - Intergenic
1096586079 12:52620805-52620827 TTGGACAACAAACAACATGTGGG - Intergenic
1096885262 12:54712284-54712306 ATAGACAGCTAACAACATTTTGG - Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1099879117 12:88445248-88445270 TTGGAAAGCGAACTCCATTTCGG - Intergenic
1100298381 12:93284314-93284336 TAGGATAGCCAAAACAATTTTGG + Intergenic
1100325734 12:93538218-93538240 TTGGTAAGCCAACAACGTTTTGG + Intergenic
1109157839 13:58933659-58933681 TTGAAAAGCCAACAGCAGTTGGG - Intergenic
1115126525 14:30001519-30001541 TTGGACACCAAACATCACTTAGG - Intronic
1117078366 14:52126716-52126738 TTGGAAACCCAACAGCATTTAGG + Intergenic
1117829289 14:59733815-59733837 TTGGAAAGCCCAAACCAATTGGG + Intronic
1119801167 14:77446623-77446645 TAGAACAGCCAAAACAATTTTGG + Intronic
1120622468 14:86781073-86781095 TTGGAAAGCAAACACCACTATGG + Intergenic
1123903351 15:24898095-24898117 TTGGACTGCTAACACCATAGGGG + Intronic
1124799292 15:32814500-32814522 TCAGACAGCAGACACCATTTAGG + Intronic
1125330298 15:38575399-38575421 TGGGACAGCCAAAAACATTGAGG - Intergenic
1130047254 15:80455132-80455154 TTGGACTGCTATCACCATCTTGG - Intronic
1137742378 16:50792512-50792534 TTTGACAGCCATGACTATTTTGG + Intronic
1138904066 16:61309165-61309187 TTGGAAAGCCAATAAAATTTGGG + Intergenic
1146579644 17:34025338-34025360 TCTGACACCCAGCACCATTTTGG - Intronic
1152184140 17:78843598-78843620 TCTGAGAGTCAACACCATTTAGG - Intergenic
1154473001 18:14722917-14722939 TTGTACAGTCAACAACAATTGGG - Intergenic
1156292148 18:35756572-35756594 TTGGCCTGCCATCCCCATTTTGG - Intergenic
1158121916 18:54057915-54057937 CTGGACTGCTAACATCATTTTGG + Intergenic
1165303380 19:34987550-34987572 TTGGCCAGCCTTCACCATGTTGG + Intergenic
1165881575 19:39047772-39047794 TTTGACAGCAGACACCACTTGGG - Intergenic
927273063 2:21234651-21234673 TTGGACAGCAGACACCCTTGTGG - Intergenic
928956188 2:36871449-36871471 TTGTAAAGCCTATACCATTTAGG + Intronic
932170928 2:69555342-69555364 TTAGAAAGCCAAAACTATTTGGG - Intronic
937733284 2:125260152-125260174 AAGGACAGCCATGACCATTTGGG - Intergenic
939492478 2:142893158-142893180 TTTGACAGTCATCAGCATTTAGG + Intronic
941346702 2:164377934-164377956 TTGCTCAGCCAACACCATTCTGG - Intergenic
944772315 2:202926561-202926583 TTGAACAGCCAAAACAACTTTGG - Intronic
946635132 2:221716713-221716735 GTGGACAGCCAAGACTATTGGGG + Intergenic
948997271 2:241588460-241588482 TAGGATAGCCAAAACAATTTTGG + Intronic
1169256701 20:4105283-4105305 TTGGAAAGCCATCACCTTTTAGG + Intergenic
1176745675 21:10650147-10650169 ATGGACAGCCTCCACCCTTTCGG + Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
950330054 3:12149103-12149125 TGGGACAGCCAACACAATAATGG - Intronic
951756884 3:26100741-26100763 TTACACAGCTAACACCATATTGG + Intergenic
952559214 3:34570184-34570206 AAGAACAGCCAAGACCATTTGGG - Intergenic
954145289 3:48631439-48631461 AGAGACAGGCAACACCATTTCGG + Intronic
959665215 3:108913253-108913275 GTGTACAGTCAACAGCATTTTGG + Intronic
965075295 3:163967708-163967730 TAGGACCTCCAACACTATTTTGG - Intergenic
965695708 3:171406396-171406418 ATTGAGAGCAAACACCATTTGGG + Intronic
967066328 3:185920264-185920286 TTGGAAAGCCAACACTTTTCAGG - Intronic
967216156 3:187212351-187212373 TTGGAGAGCCATCAGCATTTAGG + Intergenic
968381606 4:101366-101388 TTGGAGAGCCCAAACCAATTAGG - Intergenic
970557509 4:17249437-17249459 TTAGAGAGCCTAAACCATTTGGG - Intergenic
975387735 4:73777904-73777926 GAGGAAAGCCAACACCCTTTTGG - Intergenic
979273944 4:118793562-118793584 TTGGAGAGCCACCAACATTAGGG - Intronic
983174433 4:164571450-164571472 TTGGACTGCCTACAACATTTTGG - Intergenic
984030025 4:174592259-174592281 ATGTACAGCCAATGCCATTTTGG + Intergenic
984400027 4:179251480-179251502 TCTCACACCCAACACCATTTTGG + Intergenic
985759840 5:1742629-1742651 GTAGACAGCCAACAACATTCAGG - Intergenic
991509288 5:67359107-67359129 GTGGACAGCCAACTAGATTTAGG - Intergenic
994489359 5:100421875-100421897 TTAGACAGCCCAGACCATTTTGG - Intergenic
994847539 5:105009059-105009081 ATGGATAGCTTACACCATTTGGG - Intergenic
996009317 5:118463681-118463703 TTGGAATCTCAACACCATTTTGG + Intergenic
999535322 5:152510352-152510374 TTGGCCAGAGAACAACATTTTGG - Intergenic
999660526 5:153858080-153858102 AGGGAAACCCAACACCATTTTGG - Intergenic
1000229818 5:159305232-159305254 TTGGACAGCCATCCCCAGCTTGG + Intergenic
1000571421 5:162918866-162918888 GTGGATAACCAACACCATTTTGG + Intergenic
1001261811 5:170236126-170236148 TGGGACTGCCAAGACCAGTTTGG + Intronic
1004638302 6:17489545-17489567 TTGGTCATTCAACACCCTTTGGG - Intronic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1010329730 6:74609135-74609157 TTTGTCATCCAACACTATTTTGG - Intergenic
1016258606 6:142140396-142140418 TTAAAAAGCCAACACAATTTTGG + Intergenic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1022239300 7:28493740-28493762 TCAGACAGCCAAAAACATTTGGG + Intronic
1024722433 7:52152372-52152394 TCAGACATCCAAAACCATTTGGG - Intergenic
1027925105 7:84450290-84450312 TTGGTCATCCAAGACCATCTGGG - Intronic
1028035539 7:85976963-85976985 TAGCACAAGCAACACCATTTTGG + Intergenic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045946214 8:107799040-107799062 ATGAACAGCCAACATCATTTTGG + Intergenic
1049864441 8:144924861-144924883 GTGGGCAGCCAACACCTTGTGGG + Intergenic
1052017611 9:23487369-23487391 TAGGACAGCAGATACCATTTGGG - Intergenic
1059055967 9:110979915-110979937 TTGGATAACCAAGAGCATTTAGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1186177811 X:6943764-6943786 TTGGAAATGCAGCACCATTTAGG - Intergenic
1196687865 X:118527956-118527978 TTTGGCAGCCAATACCTTTTGGG - Intronic
1198326651 X:135580468-135580490 CTGGTCTGCCAACACTATTTTGG - Intronic
1201863047 Y:18620554-18620576 TTAGAAATCCAACACAATTTTGG - Intergenic
1201870276 Y:18699824-18699846 TTAGAAATCCAACACAATTTTGG + Intergenic