ID: 1044590269

View in Genome Browser
Species Human (GRCh38)
Location 8:93907559-93907581
Sequence TTGAGAGTCCCAGAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044590265_1044590269 -9 Left 1044590265 8:93907545-93907567 CCCAGCTCAGAGAATTGAGAGTC 0: 1
1: 0
2: 1
3: 9
4: 203
Right 1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG No data
1044590264_1044590269 3 Left 1044590264 8:93907533-93907555 CCTAGCTCAGATCCCAGCTCAGA 0: 1
1: 0
2: 5
3: 63
4: 517
Right 1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG No data
1044590266_1044590269 -10 Left 1044590266 8:93907546-93907568 CCAGCTCAGAGAATTGAGAGTCC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044590269 Original CRISPR TTGAGAGTCCCAGAGTTGGA GGG Intronic
No off target data available for this crispr