ID: 1044590276

View in Genome Browser
Species Human (GRCh38)
Location 8:93907618-93907640
Sequence CTAGGTAAATGGATGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044590276 Original CRISPR CTAGGTAAATGGATGATGCA TGG (reversed) Intronic
900333175 1:2146876-2146898 GTGGGTGAATGGATGATGTACGG - Intronic
900498185 1:2986101-2986123 ATAGATAAGTGGATGATGGATGG - Intergenic
900535791 1:3176598-3176620 ATAGATGAATGGATGATGGATGG - Intronic
900869190 1:5289704-5289726 ATGGGTGAATGGATGATGGATGG + Intergenic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901700220 1:11041325-11041347 GTAGGTAGAAGGATGATGGATGG + Intronic
904548983 1:31299305-31299327 CTAGAGAAATGTAGGATGCAAGG + Intronic
904757444 1:32775896-32775918 ATGGGTAAATGGGTGATGGATGG + Exonic
906680606 1:47723371-47723393 CTTGGTAAATGAATGACCCACGG - Intergenic
909269938 1:73610167-73610189 CTAGGTTAATGGTTAATGAATGG - Intergenic
910896863 1:92078989-92079011 CTAGCTAAATGGTTGTTGTAAGG + Intergenic
914351247 1:146842484-146842506 GTGGGTGAATGGATGATGGATGG + Intergenic
915800910 1:158792426-158792448 CTAGGTAACAGCATGATGCCTGG - Intergenic
917513256 1:175685709-175685731 CTAGGTAGAAGGCTGATGTAGGG - Intronic
918932552 1:190873476-190873498 CTAGGGAAATGGAGGTTACAGGG + Intergenic
919844103 1:201630098-201630120 CTGAATAAATGAATGATGCATGG + Intronic
920612738 1:207457376-207457398 AGAGGTACATTGATGATGCAAGG - Intronic
920966711 1:210707213-210707235 CCAGGTAATTGGTGGATGCACGG + Intronic
922745792 1:228042911-228042933 GTAGATATATGGATGATGGATGG + Intronic
923476430 1:234335963-234335985 CTATGTAAAAGAATGATGGAAGG + Intergenic
1065158741 10:22897020-22897042 CGAGGTAAATGGAGTTTGCAGGG - Intergenic
1066529458 10:36320506-36320528 CTAAGAAAATGGAAAATGCAAGG - Intergenic
1066612538 10:37265296-37265318 CTTGGTAAATTGAGGAGGCATGG - Intronic
1066691689 10:38035089-38035111 GAAAGTAAATGGATGATGGATGG - Intronic
1067280848 10:44871522-44871544 CTAGGGACATGAATGATGTAGGG - Intergenic
1068556366 10:58463679-58463701 TTAGGTCAATGGATGAAGCAGGG - Intergenic
1068617388 10:59134388-59134410 CCTGCTAAATCGATGATGCATGG - Intergenic
1069220051 10:65871909-65871931 TTAAGTAAATGGATGGTGAATGG - Intergenic
1070219048 10:74421315-74421337 ATAAGTAAATGGATGATGAATGG + Intronic
1073467174 10:103700979-103701001 GATGGTAAATGGATGATGGATGG - Intronic
1073467194 10:103701074-103701096 GATGGTAAATGGATGATGGATGG - Intronic
1073467218 10:103701191-103701213 GATGGTAAATGGATGATGGATGG - Intronic
1075524987 10:123176515-123176537 ATGGGTGAATGGATGATGGATGG - Intergenic
1075902089 10:126051382-126051404 GTATATAAATGGATGATGGAAGG - Intronic
1076192849 10:128495061-128495083 CCTGGTGCATGGATGATGCATGG - Intergenic
1076485384 10:130812344-130812366 CTGGATAAATGGATAAGGCAGGG - Intergenic
1078459616 11:11504188-11504210 CTAAGTAAATGAATGATGGCAGG + Intronic
1079105145 11:17566642-17566664 TTAGGTAAATGGATGGTGTATGG - Intronic
1079132571 11:17756136-17756158 CTAGGGAAATGCAAGGTGCAAGG - Intronic
1079496882 11:21054089-21054111 CTAGGTAATAGGATTATGGATGG - Intronic
1080163287 11:29205102-29205124 GTAGGTAGATAGATGATGAAAGG - Intergenic
1080491917 11:32774086-32774108 CAAGGGAAAGGGATGACGCATGG - Intronic
1081004472 11:37717914-37717936 CTAGATAAATGGCTGATTCGAGG + Intergenic
1081930216 11:46864678-46864700 ATAGGTAAATGGGAGGTGCAGGG + Intronic
1082092207 11:48099186-48099208 CAGGGTAAATGGATGATTCAGGG + Intronic
1083634622 11:64113758-64113780 ACAGGTAAATGCATGATGGATGG + Intronic
1084576525 11:69992160-69992182 GTAGATGAATGGATGATGGATGG + Intergenic
1084781803 11:71414780-71414802 GTGGGTAGATGGATGATGGATGG + Intergenic
1084781846 11:71414986-71415008 ATGGGTAGATGGATGATGGATGG + Intergenic
1087236301 11:95722624-95722646 TTAAGTAAATGGATGGTGTATGG + Intergenic
1089580049 11:119476061-119476083 ATAAGTAGATGGATGATGGATGG + Intergenic
1089598906 11:119601051-119601073 CTAAGTAAAGGGATTATTCATGG + Intergenic
1090377940 11:126304570-126304592 ATACATAAATGGATGATGAATGG - Intronic
1091635007 12:2190389-2190411 CTAGATAAACGGCTGATGGAGGG - Intronic
1092136417 12:6151160-6151182 CTAATTAAATGTATTATGCAGGG - Intergenic
1093185181 12:16012148-16012170 TTAGTTAAATGGATGTTGAAGGG + Intronic
1095781286 12:46063373-46063395 TTATGTAAATGAATGATGGATGG + Intergenic
1097478515 12:60090574-60090596 TTAAGTAAATGGATTTTGCATGG + Intergenic
1098725124 12:73954841-73954863 TGAAGTAAATGGATGATGGATGG - Intergenic
1098984115 12:76992042-76992064 TGAGGTAAATGGATGTTGGAGGG + Intergenic
1099770595 12:87048725-87048747 TTAAGTAAATGGATGATGGATGG + Intergenic
1101247376 12:102896853-102896875 CTAGGTACTTGGACAATGCAAGG + Intronic
1101259660 12:103015336-103015358 ATAGGTAAATAGATGATAGATGG - Intergenic
1103444826 12:120987993-120988015 GTGGGTAGATGGATGATGGATGG - Intronic
1103444876 12:120988182-120988204 GTGGGTAGATGGATGATGGATGG - Intronic
1104125996 12:125846666-125846688 TTCAGTAAATGGATGGTGCATGG - Intergenic
1104549203 12:129740424-129740446 CCATTTAAATGGATAATGCAAGG + Intronic
1104688990 12:130810503-130810525 CTGGGGAAATGGCTGATGCCAGG + Intronic
1104778394 12:131404591-131404613 ATAGATAAATGGGTGATGGATGG - Intergenic
1104813972 12:131635339-131635361 GAAGGTAGATGGATGATGGATGG - Intergenic
1104896101 12:132164580-132164602 CTAGGTAGACGGATGATGGATGG - Intergenic
1104896219 12:132166301-132166323 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896270 12:132166519-132166541 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896404 12:132167016-132167038 CTGGGTGAATGGATAATGGATGG - Intergenic
1108707340 13:53001534-53001556 CTAGGTTAATGGAGGGGGCAGGG + Intergenic
1109299748 13:60578723-60578745 CTAGGTAAGTAGACGTTGCAAGG + Intergenic
1109636637 13:65127341-65127363 ATAGGTAAATAGATGATAGATGG + Intergenic
1109784079 13:67151899-67151921 TTAGGCAAAATGATGATGCAAGG - Intronic
1111089860 13:83430087-83430109 ATAGGAAAATGGTTAATGCATGG - Intergenic
1111112641 13:83734340-83734362 CTAGGTGGATGGATGATGTGAGG + Intergenic
1111891036 13:94082710-94082732 CTAGGAAAATGGAAGATGCTAGG - Intronic
1111928401 13:94487459-94487481 ATTTGTAAGTGGATGATGCAGGG + Intergenic
1112532970 13:100222967-100222989 CTAAGGAAAAGGATGATTCAAGG - Intronic
1115228661 14:31133490-31133512 CTAGGTAAAGAGATGATACGAGG - Exonic
1116023818 14:39492150-39492172 CTAGGCAAATGGAAGATGGATGG - Intergenic
1116109911 14:40564793-40564815 GTAGGTACATGGATGAAGCTGGG - Intergenic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1117743275 14:58841376-58841398 CAAGGTAAAATAATGATGCAAGG - Intergenic
1118120155 14:62830773-62830795 TTAGGTCAAGGGAGGATGCAAGG + Intronic
1121530057 14:94646152-94646174 CAAGGTGCATGGATGATGCGTGG + Intergenic
1122426810 14:101614427-101614449 TTAAGTAAATGGATGGTGGATGG + Intergenic
1122601959 14:102925886-102925908 CTAGGCAGATGGATGAAGCTGGG - Intronic
1122877520 14:104675678-104675700 GTGGGTGAATGGATGATGGATGG + Intergenic
1125236848 15:37524655-37524677 CCAGGAAACTGGAAGATGCAAGG - Intergenic
1126502472 15:49361295-49361317 ATAGGTAAATTGATGTTACAGGG + Intronic
1126807418 15:52365329-52365351 GTAGGTAAATGGAGAAGGCAAGG - Intronic
1127574808 15:60280894-60280916 CTAGGAAACTTGATGATGTAGGG - Intergenic
1128707985 15:69851403-69851425 CTAATTAAATGGAAGGTGCAGGG - Intergenic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1135892936 16:26373859-26373881 ATAGGTATATGGGTGATGGATGG + Intergenic
1136506057 16:30704102-30704124 CTGGGGAACTGGATGAGGCAGGG - Exonic
1137579890 16:49627370-49627392 ATAGGTAGATGGAGGATGGATGG - Intronic
1137580027 16:49627981-49628003 ATAGGTAGATGGAGGATGGATGG - Intronic
1139252274 16:65507860-65507882 ATGGGTGAATGGATGATGGATGG - Intergenic
1139982789 16:70873062-70873084 GTGGGTGAATGGATGATGGATGG - Intronic
1140061022 16:71569809-71569831 CTAGGTCAATGCATGTTGTAAGG - Intronic
1140965526 16:79962732-79962754 CTAGCTAGATGAATGATGGATGG + Intergenic
1141110200 16:81265689-81265711 GTAGGTAGATGGATGGTGGATGG - Intronic
1143322660 17:6078240-6078262 TTAGGAAAATGAATGAGGCATGG + Intronic
1143828877 17:9635110-9635132 CTATGCAAATCGATAATGCAAGG - Intronic
1144389387 17:14779626-14779648 GTAGGAAAATGGAAAATGCATGG - Intergenic
1144890358 17:18490817-18490839 CTGGGCTAATGGAGGATGCAGGG + Intronic
1145141858 17:20453501-20453523 CTGGGCTAATGGAGGATGCAGGG - Intronic
1146091182 17:29880082-29880104 CTAGCTAGATGGATAATGGATGG - Intronic
1148532704 17:48410151-48410173 TTAAGTAAATGGATGATGAATGG + Intronic
1149216198 17:54357470-54357492 CTAGGTAGAAGTATGCTGCAGGG - Intergenic
1152001810 17:77650821-77650843 CTAGGTAAATGGATGGCAGATGG - Intergenic
1153660549 18:7322022-7322044 ATGGGTAGATGGATGATGGATGG + Intergenic
1156766638 18:40664370-40664392 CTAGGAAAATGGATTGTGGAAGG - Intergenic
1159318908 18:66819914-66819936 ATAAGTAAATAGATGATGGATGG - Intergenic
1160502547 18:79409445-79409467 ATAGGTAAATGGTGGATGAATGG - Intronic
1160681871 19:415506-415528 ATGGGTGAATGGATGATGGATGG + Intergenic
1160681879 19:415551-415573 ATGGGTGAATGGATGATGGATGG + Intergenic
1160681884 19:415574-415596 ATGGGTGAATGGATGATGGATGG + Intergenic
1161449196 19:4335147-4335169 GTAGGTGGATGGATGATGGAGGG - Intronic
1161449211 19:4335216-4335238 GTAGGTGGATGGATGATGGAGGG - Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1164110740 19:22155800-22155822 GTAGGGAAATGGATGAAGCTGGG - Intergenic
1164678877 19:30120983-30121005 GTAGGTGGATGGATGATGGATGG - Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1168135385 19:54347724-54347746 CGAGGAAAATGGATGGGGCAGGG - Intergenic
925253431 2:2462012-2462034 CTTGGTAAATAGATCAGGCAGGG - Intergenic
927249007 2:20981517-20981539 ATAGATGGATGGATGATGCATGG + Intergenic
928423162 2:31155713-31155735 CTAGGTAAGTGGAGTATGAAGGG - Intergenic
930102751 2:47615930-47615952 CTGGGGAAATGGATGAAGAAAGG - Intergenic
933439531 2:82294974-82294996 GTAGGGAAATGGATGATAAAGGG - Intergenic
934739478 2:96709376-96709398 CTTGAGAAATGGCTGATGCAGGG - Intronic
937006534 2:118521530-118521552 CCAGGGCAATGGATGATGCTTGG - Intergenic
939561126 2:143733139-143733161 TTAGGTCAATGGATGAGCCATGG + Intronic
939825371 2:147009172-147009194 TAAGGTAAATGGAAGAAGCAGGG + Intergenic
939883717 2:147658467-147658489 AAAGGTAAATGGATGTTGCAAGG + Intergenic
942942500 2:181635436-181635458 CTAGATAAATGGGTGAGGAATGG + Intronic
944359827 2:198840591-198840613 CTAAGTGAATGGAAAATGCAAGG - Intergenic
945413898 2:209546923-209546945 CTAGGAAAATGGTTTAAGCATGG + Intronic
945519017 2:210799955-210799977 TTAGGTAAATGGATGAAAGAGGG + Intergenic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
1169161015 20:3378497-3378519 CTAGGTAAATGGAAGAGCCATGG + Intronic
1172020756 20:31912266-31912288 CTAGGTCCCTGGATGCTGCACGG - Intronic
1172230790 20:33334240-33334262 ATGGGTAGATGGATGATGGATGG + Intergenic
1173871490 20:46344855-46344877 ATGGGTAGATGGATGATGGATGG - Intergenic
1174940919 20:54926168-54926190 TTAGGTAAATGGATGGTGGATGG - Intergenic
1175010411 20:55728884-55728906 CTAAGTAACAGGATGAGGCAGGG + Intergenic
1175770499 20:61620402-61620424 ATAGATAGATGGATGATGGATGG + Intronic
1175770506 20:61620473-61620495 ATAGATAGATGGATGATGGATGG + Intronic
1175780281 20:61677786-61677808 ATAGATACATGGATGATGGATGG + Intronic
1175780302 20:61678032-61678054 GTAGATAGATGGATGATGGATGG + Intronic
1175817205 20:61889426-61889448 ATAGATGAATGGATGATGCATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1177300119 21:19233044-19233066 CTAGTTAAATGAATGATGGGTGG - Intergenic
1179082185 21:38181576-38181598 GTATGTAAATGGATTTTGCAGGG + Intronic
1180182487 21:46124210-46124232 CTGGGTGGATGGATGATGGATGG + Intronic
1181536729 22:23550156-23550178 ATGGGTAGATGGATGATGGATGG - Intergenic
1181965409 22:26653099-26653121 GTAGGGAAATGGAAGATGCTAGG + Intergenic
1182014173 22:27025326-27025348 CCAGGTAAATGGATGGGGAAAGG + Intergenic
1182798437 22:33009078-33009100 CTAGATAGATAGATGATGAATGG + Intronic
1182970521 22:34570434-34570456 TTAAGTAAATGGATGGTGGATGG - Intergenic
1183425714 22:37738347-37738369 ATGGGTAGATGGATGATGGATGG + Intronic
1183482854 22:38074630-38074652 CAGGGTAAATGGATCATGGATGG - Intronic
1185053547 22:48566220-48566242 GTAGGTAGATGGATGATGGGTGG + Intronic
1185053584 22:48566405-48566427 GTAGGTGGATGGATGATGAATGG + Intronic
952355638 3:32580801-32580823 CTTGGAAAATGGATGATGAATGG + Intergenic
952518742 3:34132759-34132781 CAAAGTGAATGGATGATGAAAGG - Intergenic
952655929 3:35785452-35785474 CTAGAGGAATGGATCATGCACGG - Intronic
956332914 3:68131033-68131055 CTTAGTAACTGGATAATGCATGG + Intronic
956653280 3:71525074-71525096 CTTGGTATATGCCTGATGCAGGG + Intronic
958064872 3:88530312-88530334 CTAGATAAATGGATGAACAAGGG - Intergenic
959110359 3:102115643-102115665 CAGGATAAATGGATGAGGCAGGG - Intronic
959597975 3:108148267-108148289 ATAGGTTAATGGATGGTTCAAGG + Intergenic
961845341 3:129758192-129758214 ATAAGTAAATGGATGATGGGTGG + Intronic
962951478 3:140223559-140223581 CTAGGAAAATGAATGATGATAGG - Intronic
963541934 3:146602454-146602476 CTTGGGAAAGGGAGGATGCATGG + Intronic
965162652 3:165154376-165154398 CTAAGTAAATGGATGGTGGATGG + Intergenic
965524575 3:169702296-169702318 CCAGGCAAAGGCATGATGCAAGG - Intergenic
965651772 3:170941323-170941345 TTAAGTAAATGGATGATGCAGGG + Intergenic
966131700 3:176648323-176648345 TTATGTAAATGGTTGATGGATGG + Intergenic
967087147 3:186106135-186106157 CTGGGTAAATGGATTTGGCACGG - Intronic
967349596 3:188498030-188498052 CTAGGGAAATGGCTGTTGCATGG + Intronic
968322977 3:197787946-197787968 CTAGGTAAAGGAAGGATGGAAGG - Intergenic
968935911 4:3610270-3610292 ATGGGTGAATGGATGATGGATGG - Intergenic
969206531 4:5651409-5651431 ATGAGTAAATGGATGATGGATGG + Intronic
969599379 4:8166933-8166955 ATAGGTGAATGGATGGTGAATGG - Intergenic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
970459580 4:16259620-16259642 CTAACTAAAGGGATAATGCATGG - Intergenic
970468174 4:16348830-16348852 CTGGGTGAATGAATGATGAATGG - Intergenic
974213229 4:58810036-58810058 CTAGTTAAATGATTGCTGCAGGG - Intergenic
974861184 4:67523458-67523480 ATAAGTAAATGGATGTTGAATGG + Intronic
975255307 4:72228159-72228181 CTATGTAAATGGTAGATTCAAGG + Intergenic
976346359 4:84006687-84006709 CCAAGTAAATGGATGATAGATGG - Intergenic
978075890 4:104528993-104529015 CTTGGTAAATGGATACAGCAAGG + Intergenic
978240873 4:106514860-106514882 ATAGATAGATGGATGATGGATGG + Intergenic
978288848 4:107112918-107112940 TTAGGTAAATGGATGGTGGATGG + Intronic
978292672 4:107163487-107163509 TTAAGTAACTGGATGGTGCATGG + Intronic
978769485 4:112439505-112439527 CTTGTTAAAGGGATTATGCAAGG - Intronic
978793244 4:112684301-112684323 ATGGGTGAATGGATGATGGATGG - Intergenic
980147939 4:129013037-129013059 ATAGGTAAATGGATGTCACAGGG + Intronic
980665754 4:135931881-135931903 CTTGGTAAATGGATTATTCTGGG - Intergenic
982943275 4:161585699-161585721 CTAGGTAAATGCAGCATCCATGG - Intronic
984305809 4:177988917-177988939 TTAAGTAAATGGATGACACATGG + Intronic
985232043 4:187829012-187829034 CTACATAAATGGATTATGGAAGG - Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
986309222 5:6539316-6539338 TTGGGTGGATGGATGATGCATGG + Intergenic
987433162 5:17861490-17861512 CTAGGGAAATGCCTGATACATGG - Intergenic
990566228 5:57032227-57032249 AGTGGTAAATGCATGATGCAGGG + Intergenic
990591809 5:57273281-57273303 CTAAATAAATGTATGTTGCATGG + Intergenic
990595225 5:57306158-57306180 CTAATTAAATGTATCATGCAGGG - Intergenic
991179704 5:63735655-63735677 TAAGGTAAATAGAAGATGCATGG - Intergenic
991646971 5:68810066-68810088 CTAAGTAAATGAATGATGGGTGG - Intergenic
993152153 5:84174559-84174581 CTAGGCAAATGGAGGATGGATGG + Intronic
993677813 5:90838646-90838668 ATGGGTAAATGGATAATGAATGG - Intronic
994602651 5:101926393-101926415 CTAGGTAAATGTTTTCTGCAAGG - Intergenic
995557190 5:113341727-113341749 CAAGGTAGATGGAAGATGCCTGG + Intronic
996212301 5:120826349-120826371 ATAGATAACTGGGTGATGCAGGG + Intergenic
996876287 5:128243722-128243744 GTAAGTAGATGGATGATGGATGG + Intergenic
998601948 5:143593512-143593534 ATAAATAAATGAATGATGCATGG - Intergenic
1000997799 5:167976145-167976167 CTGGGTAGATGGATGAAGGAAGG - Intronic
1004261008 6:14107796-14107818 CAAGGTACAGGGATGGTGCAGGG + Intergenic
1004548146 6:16619391-16619413 CTAGATAAATAGATTATGGATGG + Intronic
1005089148 6:22038125-22038147 CTAAGTATATGGATGGTGGATGG + Intergenic
1005359831 6:25021337-25021359 CTAAGAAGAAGGATGATGCAAGG + Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1007843281 6:44734073-44734095 CTAGGCCAGTGGATAATGCAGGG + Intergenic
1008546356 6:52587161-52587183 ATAGGTAAATGGATGAGTGATGG + Intergenic
1010535467 6:77023569-77023591 CTAGATAAAGGGATAATGAATGG + Intergenic
1013804083 6:113977680-113977702 CTAGGTAGAGGGTTGAAGCAAGG + Intronic
1015494154 6:133863246-133863268 CTAAGCAAATGGAAAATGCAGGG - Intergenic
1015646159 6:135391234-135391256 CTAGGTAAAAGAATTATCCAAGG - Intronic
1016255711 6:142102757-142102779 CTTGATAAATGGAAGATGAAGGG - Intergenic
1018158487 6:161013528-161013550 CTAGGAAAATAATTGATGCAGGG + Intronic
1019479978 7:1261889-1261911 ATAGATAGATGGATGATGGATGG - Intergenic
1019777420 7:2920554-2920576 ATACGTAGATGGATGATGGATGG - Intronic
1019998052 7:4737820-4737842 CTTAGAAAATGGGTGATGCAAGG + Intronic
1021743877 7:23717996-23718018 CTATGGAGATGGATGATGAATGG + Intronic
1023172382 7:37402231-37402253 CTTGATAAATGGATGAGGCCAGG + Intronic
1024467217 7:49723912-49723934 CTAAGTAAATGGGTGATAGATGG - Intergenic
1025956734 7:66188833-66188855 ATAGATAAATAGATGATGGATGG - Intergenic
1026501559 7:70947253-70947275 CCAAGTAAGTGGATGAGGCAGGG + Intergenic
1031053974 7:116973878-116973900 ATAGGTAAATTAATGCTGCATGG + Intronic
1031593484 7:123621444-123621466 ATAGGAAAATGGATTATTCATGG + Intronic
1031668481 7:124514903-124514925 CAAGGTGAATGGAGGATACAGGG + Intergenic
1031783311 7:125997618-125997640 CTAGGCAAATGTTTGCTGCAGGG + Intergenic
1032479074 7:132232294-132232316 CCTGGGAAATGGATGAAGCAGGG - Intronic
1034308361 7:150065060-150065082 CTAGATAAAAGCATGATGCTGGG + Intergenic
1034688046 7:152991009-152991031 ATAGATAAATAGATGATGGATGG - Intergenic
1034749041 7:153551546-153551568 ATAGTTAATTGTATGATGCATGG + Intergenic
1034798492 7:154035613-154035635 CTAGATAAAAGCATGATGCTGGG - Intronic
1034883617 7:154780890-154780912 ATAGATAAATGCATGATGGATGG + Intronic
1035279103 7:157766112-157766134 ATAAGTAGATGGATGATGGATGG - Intronic
1035279154 7:157766343-157766365 ATGGGTAGATGGATGATGGATGG - Intronic
1036457151 8:8919889-8919911 TTAAGTAAATGGATGATTGACGG - Intergenic
1037234987 8:16709175-16709197 CTATGTAAATGGCTGAAGGATGG - Intergenic
1040998479 8:53425866-53425888 TTAAGTAAATGAATGATGCATGG + Intergenic
1041424920 8:57709701-57709723 AGAAGTAAATGGATGGTGCAGGG - Intergenic
1041748295 8:61232738-61232760 CAAGGTAACTGCATGATGCTGGG - Intronic
1041791983 8:61706668-61706690 CTAGAGAAATGGATGAGGAAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1047266078 8:123310341-123310363 ATAGGTAAATGGGTGGTGAAAGG + Intergenic
1048783493 8:138026151-138026173 CTAGGAATAGGGATGAGGCAGGG + Intergenic
1051606307 9:18920685-18920707 CTAGCTAAAAGGATGTTGTAAGG + Intergenic
1051685537 9:19654557-19654579 CTAGGTAAAGGAATGGGGCATGG + Intronic
1052144231 9:25027265-25027287 TTAGGGAAAAGGATGATGCCTGG - Intergenic
1054454305 9:65421712-65421734 ATGGGTAGATGGATGATGAATGG + Intergenic
1054454309 9:65421731-65421753 ATGGGTGAATGGATGATGGATGG + Intergenic
1055140483 9:72871514-72871536 CTAGGAAAATAGAATATGCAGGG + Intergenic
1055737803 9:79351048-79351070 CTATGAATATGGATTATGCAAGG + Intergenic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1058914624 9:109553777-109553799 CTTGGTGAATGGATGATGGGTGG + Intergenic
1059409070 9:114120725-114120747 ATAGATAGATGGATGATGAATGG + Intergenic
1060165438 9:121410200-121410222 TTAAGTAAATGGATGGTGGATGG - Intergenic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1062257624 9:135635910-135635932 TTAAATAAATGGATGAGGCATGG - Intronic
1062447965 9:136603650-136603672 CTAGGGGAATGGAGAATGCAGGG - Intergenic
1185809404 X:3091783-3091805 ATAGGTAAATAGATGATAGATGG + Intronic
1186266627 X:7840566-7840588 CCAGGTAAATGTTTGCTGCAGGG - Intergenic
1186703128 X:12112930-12112952 CTAGCTAAATGGTTGGTTCAAGG + Intergenic
1188633798 X:32402501-32402523 CTAGATGAATGGTTGAGGCATGG - Intronic
1189279890 X:39813621-39813643 CTGAGTAGATGGATGTTGCATGG + Intergenic
1190630086 X:52377830-52377852 CTAGGAAAATGGATAAAGAATGG + Intergenic
1190653884 X:52594141-52594163 CTAGGGAGATGGATGAAGAATGG + Intergenic
1192387656 X:70689091-70689113 TTAAGTAAATGAATGATGGATGG + Intronic
1193525889 X:82588570-82588592 ATAGGTTAATGGGTGATACATGG - Intergenic
1193608359 X:83596237-83596259 CTAGGTAACTGGATGAAATATGG - Intergenic
1194372951 X:93096848-93096870 CTGGATAAATGGTTGATTCAAGG + Intergenic
1195365036 X:104116914-104116936 GTAGGTATATGGATGGAGCAGGG - Intronic
1196752229 X:119128430-119128452 CTAGGTGAAGGGATGAAGTAGGG - Intronic
1200680987 Y:6210885-6210907 CTGGATAAATGGTTGATTCAAGG + Intergenic
1201245112 Y:11995865-11995887 ATAGATAAATAGAAGATGCATGG + Intergenic
1201612616 Y:15860209-15860231 CAAGATAAATGGATTATGAATGG - Intergenic
1201747138 Y:17389198-17389220 GTAGATAAATAGATGATGGATGG + Intergenic