ID: 1044591311

View in Genome Browser
Species Human (GRCh38)
Location 8:93916841-93916863
Sequence GTGACGAGTGGGAGGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 1009}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591311_1044591325 25 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591311_1044591326 28 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591311_1044591320 -1 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591320 8:93916863-93916885 CTGCGCAGCCAATCGGCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1044591311_1044591318 -8 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591311_1044591324 24 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591311_1044591321 0 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591311_1044591323 11 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591311_1044591319 -4 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591319 8:93916860-93916882 TCACTGCGCAGCCAATCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1044591311_1044591329 30 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591311_1044591327 29 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591311 Original CRISPR GTGACGAGTGGGAGGGGAGG CGG (reversed) Intronic
900002260 1:21206-21228 GTGACGACTGGCAGTGGAGTGGG - Intergenic
900021979 1:191730-191752 GTGACGACTGGCAGTGGAGTGGG - Intergenic
900088192 1:908602-908624 GGAACAGGTGGGAGGGGAGGAGG + Intergenic
900088245 1:908719-908741 GGGACAGGTGGGAGGGGAGAGGG + Intergenic
900097825 1:947516-947538 GTGCCTAGTGGAAGGGGTGGGGG - Intronic
900166194 1:1245158-1245180 GTGAAAAGTGGGGGAGGAGGGGG - Intronic
900244500 1:1631013-1631035 GTGACGAGCTGGGGGGGCGGGGG + Intergenic
900412546 1:2519408-2519430 GAGCTGAGTGGGAGGGGAGGGGG + Intronic
900412555 1:2519436-2519458 GAGCTGAGTGGGAGGGGAGGGGG + Intronic
900478549 1:2887430-2887452 GTGAGGAATGGGTGGGGAGGTGG + Intergenic
900626465 1:3610909-3610931 GGGGAGAGTGGGAGGGGGGGAGG + Intronic
901494155 1:9611900-9611922 CTGAGGTGCGGGAGGGGAGGGGG + Intronic
901715836 1:11153176-11153198 GAGAGGAGTGGAAGGGGAAGGGG + Intronic
901879416 1:12185208-12185230 GTGACCTGGGGGAGGGGTGGCGG - Intronic
902162107 1:14538956-14538978 GAGGCGAGTGGATGGGGAGGAGG + Intergenic
902630384 1:17701244-17701266 GTGAGGGTTGGAAGGGGAGGGGG + Intergenic
902651646 1:17841389-17841411 TTGATGTGGGGGAGGGGAGGAGG - Intergenic
902667472 1:17949630-17949652 GGGGCGAGTGAGAGAGGAGGAGG - Intergenic
902825312 1:18969361-18969383 GTGCTGGGTGGGAGGGTAGGGGG + Intergenic
902981861 1:20129206-20129228 GGGTCCAGTGGGAGGGGAGCAGG - Intergenic
903100163 1:21023233-21023255 GGGGGGAGGGGGAGGGGAGGGGG - Intronic
903464682 1:23543907-23543929 GAGAGCAGTGGGCGGGGAGGTGG - Intergenic
903475351 1:23615685-23615707 GTGACGTCGGGGAGGGGATGGGG - Intronic
903603361 1:24557677-24557699 ATGCCTGGTGGGAGGGGAGGAGG + Intronic
903625977 1:24730353-24730375 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
903812369 1:26041860-26041882 GTGCTGGGTGGGAGGGGAGAAGG - Intronic
903989183 1:27253401-27253423 GGGAGGAGGAGGAGGGGAGGGGG - Intronic
904121329 1:28199928-28199950 GTGATGAGTGGGTGGGTGGGTGG - Intronic
904127186 1:28249272-28249294 GAGATTAGTGGGTGGGGAGGGGG + Intergenic
904468091 1:30719604-30719626 GAGCCTAGTGGGAGGGGAGCAGG - Intronic
904480750 1:30791768-30791790 AGGAAGAGAGGGAGGGGAGGAGG + Intergenic
904900247 1:33851506-33851528 GTGACAGGTGGGAAGGGAAGAGG - Intronic
905230411 1:36511662-36511684 GGGAAGAGTGGGAGGGGCGAGGG + Intergenic
905442984 1:38006220-38006242 GTGAGGAGTGTGAGAGGATGGGG + Intergenic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
905673295 1:39807620-39807642 GGGACGAGGGAGAGGGGAGAGGG - Intergenic
905875791 1:41431352-41431374 GTGAGGAGTGAGGGGGAAGGGGG + Intergenic
906131402 1:43460572-43460594 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
906472836 1:46145478-46145500 GTGCAGAGTGGAAGGGGAGCTGG + Intronic
906472999 1:46146668-46146690 GTGTAGAGTTGGAGGGGAGGGGG - Intronic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907696074 1:56730408-56730430 AGGAGGAGAGGGAGGGGAGGGGG + Intronic
907856386 1:58307763-58307785 GTGGGGAGTGGGGGTGGAGGAGG + Intronic
908669846 1:66533961-66533983 GTGACAAGCGGGAGGCGATGGGG + Intronic
908671010 1:66547805-66547827 GTGGAGAATGGGAGGGGTGGCGG + Intronic
908763287 1:67531728-67531750 GTGCAGAGTGGAAGGGGAGGGGG + Intergenic
908816038 1:68035515-68035537 GTGCCGAGTGAATGGGGAGGAGG + Intergenic
909664715 1:78120470-78120492 GTGGGCAGTGGGAGGGGTGGAGG - Intronic
910101398 1:83582325-83582347 GTGGCGAGTGGTAGGGGGAGGGG + Intergenic
910363744 1:86441574-86441596 GTGGGGAGTGGGAAGGGAGAAGG + Intronic
910569715 1:88685082-88685104 GTGCGGAGTCTGAGGGGAGGGGG - Intronic
910683787 1:89894999-89895021 GTGATCAGTGGGTGGGGTGGGGG - Intronic
910745962 1:90575278-90575300 GTGGCCAGGGGGTGGGGAGGGGG + Intergenic
911168313 1:94744820-94744842 GTGAAGTGTGGGAGGGGAGGTGG + Intergenic
911715633 1:101129640-101129662 GGGAAGGGTGGGAGGGGATGAGG - Intergenic
913321475 1:117591606-117591628 AAGAGGAGTGGGAGAGGAGGGGG + Intergenic
915029788 1:152868282-152868304 GTGAGGAATGGGAGTGGGGGTGG - Intergenic
915169633 1:153968706-153968728 GTGACGAGTGGGAGTGGGGGTGG + Intronic
915325905 1:155081014-155081036 GTGACTAGGGGGAGGGGGCGCGG - Intronic
915470253 1:156121677-156121699 GTGGCGAGGGGCTGGGGAGGAGG - Intronic
915472641 1:156135136-156135158 GTGGTGACTGGGAGGGGTGGAGG - Intronic
915551526 1:156638204-156638226 GTGTGGAGTGGGAGGGGATGTGG - Intergenic
915553822 1:156650244-156650266 ATGAGGAGGGGCAGGGGAGGGGG + Intronic
915557065 1:156666739-156666761 GTGGCCAGTGGGGGAGGAGGGGG - Intergenic
915565405 1:156710183-156710205 GTGAAGGGTGGGAGTGGTGGAGG - Intergenic
916131806 1:161617379-161617401 GGGGAGAGGGGGAGGGGAGGGGG + Intronic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
916756448 1:167774822-167774844 GTGTCTAGTGGGAGTGGAAGAGG - Intronic
916809896 1:168296108-168296130 GTGGCGAGTGGGCGTGGGGGTGG + Intronic
916851962 1:168712987-168713009 GTTATGAGAGGGAGGGGAGAAGG + Intronic
917125330 1:171682557-171682579 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
917359338 1:174159446-174159468 GGGCCGAGAAGGAGGGGAGGAGG - Intronic
917484919 1:175447208-175447230 GGGAGGAGTGGGTGAGGAGGGGG + Intronic
918142582 1:181731959-181731981 GAGATGAGGGGGAGAGGAGGAGG + Intronic
918332176 1:183471618-183471640 GTGGGAAGTGGGAAGGGAGGAGG + Intergenic
920079353 1:203361019-203361041 GTGAGGAGTGGGAGGGAGCGGGG + Intergenic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
921081120 1:211739029-211739051 GGGGAGAGTGGGAGGAGAGGAGG - Intergenic
921121287 1:212139909-212139931 GGGAAGAGTGGCAGGGGAGGAGG - Intergenic
921337021 1:214098393-214098415 GTGAAGGGTGGGAGGGAAGAGGG + Intergenic
922209974 1:223479173-223479195 GTGAGGAGGTGGGGGGGAGGGGG + Intergenic
922314967 1:224434423-224434445 GCGAGGCGGGGGAGGGGAGGCGG + Intronic
923051771 1:230395067-230395089 GGGAGGAGTGTGAGGGGAGGAGG - Intronic
923051787 1:230395112-230395134 GGGAGGAGTGTGAGGGGAGGAGG - Intronic
923051807 1:230395165-230395187 GGGAGGAGTGTGAGGAGAGGAGG - Intronic
923051851 1:230395311-230395333 GGGAGGAGTGTGAGGAGAGGAGG - Intronic
923051884 1:230395423-230395445 GGGAGGAGTGGGAGGAGAGGAGG - Intronic
923051972 1:230395713-230395735 GGGAGGAGTGTGAGGAGAGGAGG - Intronic
923092650 1:230751850-230751872 GTGGGGTGGGGGAGGGGAGGGGG + Intronic
923376587 1:233369862-233369884 GTGACGAGTGAGAGGAGAATAGG + Intronic
923602086 1:235412182-235412204 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924769796 1:247069038-247069060 GTGGCGAGCTGGAGGAGAGGTGG + Intronic
924802457 1:247337436-247337458 AGGAAGAGGGGGAGGGGAGGAGG + Intergenic
1062860049 10:803770-803792 GCCACGAATGGGAGGGAAGGTGG - Intergenic
1063353124 10:5374236-5374258 GTGGGGAGGGGGAGGGGAGGGGG + Exonic
1063904816 10:10770651-10770673 GTGAGGAGTGGGGGGTGGGGTGG - Intergenic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064266243 10:13827809-13827831 AGGAGGAGTGGGAGAGGAGGAGG + Intronic
1064768466 10:18698755-18698777 GTGACCAGGAGGAGGGGTGGGGG - Intergenic
1065277546 10:24100059-24100081 GACAGGAGAGGGAGGGGAGGAGG - Intronic
1067042987 10:42966876-42966898 AGGAAGAGTGGGAGGGGACGAGG - Intergenic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067837671 10:49651612-49651634 CTGGAGAGTGGGTGGGGAGGTGG - Intronic
1067964128 10:50889679-50889701 GAGACCAGTAAGAGGGGAGGTGG + Intergenic
1067972861 10:50991886-50991908 GTGGCGTGGGGGTGGGGAGGAGG + Intronic
1068064015 10:52105962-52105984 GGGAAGAGTGGGAGGGGAGTGGG - Intronic
1068529951 10:58174609-58174631 GTGAGGAGTGGTGGGGGTGGGGG - Intergenic
1068760234 10:60699127-60699149 GGGAAGGGTGGGAGGGGACGAGG + Intronic
1069016780 10:63438626-63438648 GTGAAAAGTGGGAGAGGAGAAGG - Intronic
1069149970 10:64948006-64948028 GGGAAGAGTGGGAGGGGTCGAGG - Intergenic
1069157286 10:65046800-65046822 GTGTAGAGTGGGAGGAGGGGAGG + Intergenic
1069288725 10:66749362-66749384 GTGAAGAGGGAGAGGTGAGGAGG - Intronic
1069666315 10:70162477-70162499 GGGAGGAGGGGGAGGGGAGGAGG + Intronic
1069666322 10:70162491-70162513 GGGAGGAGGGGAAGGGGAGGAGG + Intronic
1069720850 10:70548556-70548578 GTGCTGAGTGGGAGGGGCAGTGG + Intronic
1069721861 10:70554933-70554955 GGGAGGAGGGGGAGGGGAGGGGG - Intronic
1069721874 10:70554954-70554976 GGGAGGAGGGGGAGGGGAGGGGG - Intronic
1070161339 10:73868361-73868383 AAGACAGGTGGGAGGGGAGGGGG + Intronic
1070772795 10:79092059-79092081 ATGCTGAGTGGGAGAGGAGGTGG + Intronic
1070781683 10:79141133-79141155 GGGACGAGGGAGAGGGGACGTGG + Intronic
1072728316 10:97828375-97828397 GGGACTATTGGGAGGGGAGGGGG - Intergenic
1073843811 10:107528975-107528997 GTGGGGAGGGGGAGGGGGGGAGG + Intergenic
1074158234 10:110816445-110816467 GTGACGAGAGGGAGGGGAGCAGG - Intronic
1074748821 10:116563533-116563555 GAGAAGAGTGGGAGGGGCGAGGG - Intronic
1074753754 10:116609813-116609835 CTGGCGGGTGGGGGGGGAGGAGG - Intergenic
1075442889 10:122493827-122493849 GGGAGGAGGGGAAGGGGAGGAGG - Intronic
1075616445 10:123893474-123893496 ATGACCAGAGGGAGAGGAGGAGG + Intronic
1075934476 10:126327592-126327614 GAGATGAGGGGGTGGGGAGGGGG - Intronic
1075976394 10:126699826-126699848 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
1076112328 10:127870852-127870874 GTCAGGAGTGGGCTGGGAGGTGG - Intergenic
1076542649 10:131223944-131223966 GAGAGAAGTGGGAGGGGAGAAGG - Intronic
1077163773 11:1125968-1125990 GTGACGGGTGGCAGTGGACGTGG + Intergenic
1077166710 11:1144834-1144856 GGGAAGAGTGGGAGGGGGTGAGG - Intergenic
1077207511 11:1352008-1352030 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207594 11:1352212-1352234 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207667 11:1352383-1352405 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207686 11:1352426-1352448 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207769 11:1352630-1352652 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207804 11:1352715-1352737 GTGAGGCCTGGGAGGGGAGTTGG - Intergenic
1077207873 11:1352877-1352899 GTGAGGCCTGGGAGGGGAGTCGG - Intergenic
1077207932 11:1353028-1353050 GTGAGGCCTGGGAGGGGAGTCGG - Intergenic
1077557231 11:3231553-3231575 GGGAGGAGAAGGAGGGGAGGAGG + Intronic
1077557254 11:3231619-3231641 GGGAGGAGAAGGAGGGGAGGAGG + Intronic
1078488911 11:11751248-11751270 GTGTGGGGTGGGTGGGGAGGGGG - Intergenic
1078602819 11:12748734-12748756 GTGGCGAGAGTGTGGGGAGGCGG + Intronic
1078991181 11:16648025-16648047 GGGACGAGTGGGAGTGGCTGTGG + Intronic
1079474120 11:20810362-20810384 GAGACGAGTGAGAGGGGGTGAGG - Intronic
1079536599 11:21522565-21522587 GTGCGGGGTGGGAGGGGAGGTGG + Intronic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1080119596 11:28661954-28661976 GTTAGGAGGGGGATGGGAGGTGG - Intergenic
1080443807 11:32318665-32318687 GTGAAGAAGGGAAGGGGAGGAGG + Intergenic
1081636289 11:44724459-44724481 GTGAGGAGTGGGAGTGGAGGGGG + Intergenic
1081720744 11:45286400-45286422 GTCACGTGTTGGCGGGGAGGGGG - Intergenic
1082028144 11:47587396-47587418 ATGACTATAGGGAGGGGAGGAGG + Intronic
1083274425 11:61588602-61588624 GTGGCCCGTGGGAGGTGAGGGGG + Intergenic
1083616410 11:64028674-64028696 GGGAGGAGGGGGAGGGGAAGAGG - Intronic
1083617940 11:64035721-64035743 GAGAGGAGGAGGAGGGGAGGGGG - Intronic
1083630147 11:64091114-64091136 GGGAAGAGAGGGTGGGGAGGGGG + Intronic
1083967438 11:66051393-66051415 GTGGGGAGTGGGAGGCAAGGTGG + Intronic
1083997472 11:66279318-66279340 GAGAGGAGCGGGAGGGGAGGAGG - Intronic
1084104925 11:66975073-66975095 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1084289436 11:68152391-68152413 ATGACCACTGGGAAGGGAGGAGG - Intergenic
1084369068 11:68726253-68726275 CTGGCTGGTGGGAGGGGAGGAGG + Intronic
1084657907 11:70529697-70529719 GTTACCAGTGGGAGGGGGAGGGG - Intronic
1084873908 11:72116748-72116770 GAGCAGTGTGGGAGGGGAGGTGG + Intronic
1084931654 11:72561101-72561123 GAGAGGAATGGCAGGGGAGGAGG + Intergenic
1084943486 11:72626620-72626642 GGCAGGAGTGGGAGGGGAGAAGG - Intronic
1085073549 11:73571229-73571251 GTGGGGAGGGGGGGGGGAGGGGG - Intronic
1085199448 11:74692860-74692882 GTGATGAGGGAGAGGGGAGTGGG - Intergenic
1085502689 11:77038050-77038072 GGAATGAGTGGGAGGGGATGAGG + Intronic
1085502696 11:77038064-77038086 GGGATGAGGGGGAGGGGATGAGG + Intronic
1085592641 11:77778204-77778226 GAGAGGATGGGGAGGGGAGGGGG + Intronic
1086352619 11:85958020-85958042 GTTACAAGGGGGAGGGAAGGGGG - Intronic
1086978932 11:93172393-93172415 GGGAAGAGTGGGAGGGGACAAGG - Intronic
1087580403 11:100044042-100044064 GGGAAGAGTGGGAGGGTGGGAGG - Intronic
1088014741 11:105045148-105045170 GGGAGGAGTGGGAGGAGAGAAGG - Intronic
1088376944 11:109151719-109151741 GAGGGGAGGGGGAGGGGAGGAGG - Intergenic
1088377425 11:109158124-109158146 GTGGCGGGGGGGATGGGAGGTGG + Intergenic
1088598735 11:111457727-111457749 GTGAGCTGTGGGAGGGAAGGAGG - Intronic
1088921565 11:114262982-114263004 GTCACAAATGGCAGGGGAGGTGG + Intronic
1089500147 11:118927192-118927214 GTGAGGAGGGGCAGGGGAGAGGG - Intronic
1089567273 11:119378404-119378426 GTGACAGGCTGGAGGGGAGGAGG - Intronic
1090372044 11:126263138-126263160 GTGAAGGATGGGAGGGGAGGGGG + Exonic
1090756650 11:129797777-129797799 GTGATGAGTGGGAGGTGTTGTGG + Intergenic
1090819826 11:130331491-130331513 GTGAGGAGTGGGCGGGGTAGGGG + Intergenic
1090828117 11:130402087-130402109 GGGCAGAGTGGGAGTGGAGGAGG + Intergenic
1091070465 11:132558300-132558322 GGGAGGAGGGGGAGAGGAGGAGG - Intronic
1091070481 11:132558332-132558354 GGGAGGAGGGGGAGAGGAGGAGG - Intronic
1091375678 12:23268-23290 GTGACGACTGGCAGTGGAGTGGG - Intergenic
1091400571 12:178280-178302 GTGACGGGTGTGCGGGGAGAGGG - Exonic
1091422996 12:359760-359782 GGGGGGAGTGGGAGGGAAGGAGG + Intronic
1091441898 12:517474-517496 GTGTCTTGTGGGAGGCGAGGGGG + Intronic
1091452177 12:579631-579653 GTGACAAGAGGGAGTGGGGGCGG - Intronic
1091493587 12:952989-953011 GGGGAGAGGGGGAGGGGAGGGGG + Intronic
1091585199 12:1811882-1811904 CTGGGGAGTGGGAGGGGTGGGGG + Intronic
1091641306 12:2239612-2239634 GAGGCGAGTGGGAGGGAAGAGGG - Intronic
1091670123 12:2446615-2446637 GTGGTGAGTGGGTGGGTAGGTGG + Intronic
1091885721 12:4015721-4015743 GTGAGGGGTAAGAGGGGAGGAGG - Intergenic
1092254205 12:6917395-6917417 GAGAGGAATGGGTGGGGAGGAGG - Intronic
1092466787 12:8740483-8740505 GAGAAGAGTGGGAGGGGGTGAGG - Intronic
1092793458 12:12088844-12088866 GTGAAGAGCTGGAGGAGAGGAGG + Intronic
1092798202 12:12135316-12135338 GTGAGGATGGGGAGAGGAGGGGG + Intronic
1092798207 12:12135327-12135349 GAGAGGAGGGGGAGTGGAGGGGG + Intronic
1092817268 12:12322990-12323012 GAGGGGAGGGGGAGGGGAGGAGG + Intergenic
1092817294 12:12323030-12323052 GAGGAGAGGGGGAGGGGAGGGGG + Intergenic
1092817323 12:12323092-12323114 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1092817340 12:12323119-12323141 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1092817364 12:12323167-12323189 GAGAGGAGGGGGAGGGGAGCGGG + Intergenic
1092968494 12:13669008-13669030 GGGAGGGGAGGGAGGGGAGGTGG + Intronic
1093110782 12:15149434-15149456 GGCACTGGTGGGAGGGGAGGTGG + Intronic
1093736561 12:22625946-22625968 ATTACTGGTGGGAGGGGAGGAGG - Intronic
1094023789 12:25941561-25941583 GTGCAGAGAGGGAGTGGAGGAGG - Intergenic
1094597092 12:31875306-31875328 GTGGGGAGAGGGAAGGGAGGTGG + Intergenic
1095444018 12:42267190-42267212 GTGGCCAGTGGGAGGAGAGGGGG + Intronic
1095554750 12:43487420-43487442 GGGAAGAGTGGGAGGGTGGGAGG + Intronic
1095893475 12:47257042-47257064 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1096024781 12:48351015-48351037 GAGAGGAGTGGGAGGGAGGGAGG + Intronic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096182881 12:49560149-49560171 GGCCCCAGTGGGAGGGGAGGGGG + Intronic
1096356885 12:50948871-50948893 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1096356915 12:50948917-50948939 GGGGGGAGGGGGAGGGGAGGAGG + Intergenic
1096528403 12:52228109-52228131 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1096751012 12:53758908-53758930 GAGACAGATGGGAGGGGAGGTGG - Intergenic
1096840659 12:54377857-54377879 GAGAGGAGTGGGATGGAAGGGGG + Intronic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1097110248 12:56652459-56652481 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1097338826 12:58414735-58414757 GTGGGGAGTGGGTGGGGGGGTGG + Intergenic
1100540287 12:95550887-95550909 GTGCGGAGTGGGAAGGGAAGAGG + Intronic
1100720125 12:97349058-97349080 GTGACGGGTGGGAGTGGGGAGGG + Intergenic
1101576039 12:105997285-105997307 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1101673315 12:106896647-106896669 GGGAGGAAGGGGAGGGGAGGGGG + Intergenic
1101673329 12:106896673-106896695 GGGAGGAAGGGGAGGGGAGGGGG + Intergenic
1101812270 12:108117983-108118005 CTGAAGAGTGGGAGGGGAAATGG - Intergenic
1101882899 12:108638225-108638247 GTGACCACTGGCAAGGGAGGTGG - Intergenic
1101930130 12:109006969-109006991 GTGGCCAGTGGGAGAAGAGGTGG + Intronic
1102145350 12:110651066-110651088 GGGAGGAGAGGGAGGTGAGGGGG + Intronic
1102196027 12:111025718-111025740 GGCACAAGTGGGAGGGGAGAAGG - Intergenic
1102417043 12:112772876-112772898 GGGAAGAGTGGGAGGGGGTGAGG - Intronic
1102789871 12:115635980-115636002 AAGAGGAGGGGGAGGGGAGGAGG + Intergenic
1102808106 12:115799721-115799743 AGGAGGAGGGGGAGGGGAGGGGG + Intergenic
1102821825 12:115915059-115915081 TTGAAGAGTGGGAGGGTAGGGGG + Intergenic
1102840360 12:116113726-116113748 GAGAGGAGGGGGAGGGGAAGAGG + Intronic
1102931149 12:116863319-116863341 CTGACCAGTGGGAGGGGAGCTGG - Intronic
1102960714 12:117091695-117091717 GTGGGCAGTGGGAGGGGAGTGGG - Intronic
1103163355 12:118749597-118749619 GTGATGAGGAGGAGAGGAGGTGG - Intergenic
1103524595 12:121559341-121559363 GGGAGGGGTGGGAGGGGAAGTGG + Intronic
1103723206 12:122985663-122985685 GTGGCCAGTGGATGGGGAGGTGG + Exonic
1104288097 12:127443792-127443814 GTGGAGGGTGGGAGGGGAGAGGG - Intergenic
1104599012 12:130139814-130139836 GGGACGTGGGGGAGGCGAGGGGG - Intergenic
1104716230 12:131018198-131018220 TGGAGGAGTGGGAGAGGAGGGGG - Intronic
1104749898 12:131231758-131231780 GGGAGGAGGAGGAGGGGAGGAGG - Intergenic
1105008100 12:132735700-132735722 CTGACCTGGGGGAGGGGAGGCGG + Intronic
1105353062 13:19633455-19633477 GTCAAGGGTGGGAGGGGAGCCGG - Intergenic
1105918805 13:24941596-24941618 GTGGCACGGGGGAGGGGAGGGGG - Intergenic
1106281086 13:28272213-28272235 GAAAAGAGAGGGAGGGGAGGGGG - Intronic
1106856427 13:33858469-33858491 GTGAAGAGTGGGAAGGGACCTGG - Intronic
1106929327 13:34646904-34646926 GTGAATAGTGGGAGGGAGGGAGG + Intergenic
1107185116 13:37508681-37508703 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
1107482330 13:40795126-40795148 GTGGCATGGGGGAGGGGAGGGGG - Intronic
1108061417 13:46537195-46537217 GAGACGAGAGGGAGGGAGGGAGG - Intergenic
1108664404 13:52615536-52615558 GTGGGGAGTTGGAGGGGAGGTGG + Intergenic
1108910537 13:55545642-55545664 GTGGCAAGTGGGAGGTGAAGGGG + Intergenic
1111192825 13:84832180-84832202 GTGGCAAGTGGCAGGGGAGGTGG - Intergenic
1111485433 13:88892919-88892941 GGGAAGAGTGGGAGGGGGTGAGG - Intergenic
1112328610 13:98460330-98460352 TTTCGGAGTGGGAGGGGAGGGGG - Intronic
1112341657 13:98557502-98557524 GCCACCAGTGGGTGGGGAGGAGG - Intronic
1112506909 13:99981090-99981112 GCGAGCAGGGGGAGGGGAGGAGG - Intergenic
1113318922 13:109213350-109213372 AGGATGAGTGGGAGGAGAGGGGG + Intergenic
1113416913 13:110136071-110136093 GGGAGGAGTAGGATGGGAGGAGG - Intergenic
1113428791 13:110231290-110231312 GTGAGAAGGGGGAGGTGAGGAGG + Intronic
1113671680 13:112179714-112179736 GTGATGAGTGCGGGAGGAGGCGG - Intergenic
1113789563 13:113020665-113020687 GGGGCTTGTGGGAGGGGAGGAGG - Intronic
1113823354 13:113231438-113231460 GTGGGGAGTGGGAGGTGGGGAGG + Intronic
1113881567 13:113629662-113629684 GTGATGTGTGGTAGGAGAGGTGG + Intronic
1113887903 13:113670666-113670688 GTGTCCAGGCGGAGGGGAGGGGG + Intronic
1113887918 13:113670712-113670734 GTGCCCAGGCGGAGGGGAGGGGG + Intronic
1113887934 13:113670757-113670779 GTGCCCAGGCGGAGGGGAGGGGG + Intronic
1113909714 13:113836325-113836347 AAGAGGAGGGGGAGGGGAGGAGG + Intronic
1114233073 14:20801413-20801435 GTGAAGAGTGGGTTGTGAGGTGG - Exonic
1114475240 14:22989681-22989703 AAGAGGAGTGGGAGGAGAGGGGG + Intronic
1114553896 14:23550814-23550836 GCGTGGAGTGGGAGGGGACGTGG - Intronic
1114630276 14:24155127-24155149 GTGAGGGGTTGGAGGGGAGGGGG - Intronic
1115119012 14:29917031-29917053 GTGAGGAGTTAGAAGGGAGGGGG + Intronic
1115389789 14:32841975-32841997 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1115410117 14:33064576-33064598 GTGAGTGGTGGGCGGGGAGGGGG + Intronic
1115724163 14:36194686-36194708 GGGGAGAGGGGGAGGGGAGGGGG + Intergenic
1115927329 14:38449775-38449797 GTGATCATTGGGAGGAGAGGAGG - Intergenic
1116430135 14:44836319-44836341 GTGACGAGTGACAGCGGCGGTGG - Intergenic
1116808603 14:49517948-49517970 GGGAAGGGTGGGAGGGGAGGAGG + Intergenic
1117272817 14:54162608-54162630 GAGAGAAGTGGGTGGGGAGGGGG - Intergenic
1117290116 14:54324236-54324258 GGGAAGAGTGGGAGGGGGCGAGG + Intergenic
1117848882 14:59946648-59946670 GTGAGGAGTGGGGAGGGGGGAGG - Intronic
1117899002 14:60514553-60514575 GTGACGGGTGGAAGTGGAGTGGG - Intronic
1117962234 14:61174816-61174838 CTGATGAGGGGAAGGGGAGGAGG + Intergenic
1118253460 14:64183967-64183989 GTGGGGAGGGGGAGGGGAGGGGG + Intronic
1119195802 14:72715877-72715899 GTAATGAGGGCGAGGGGAGGAGG - Intronic
1119730407 14:76947524-76947546 GAGAGGAGAGGAAGGGGAGGGGG - Intergenic
1119765275 14:77183783-77183805 GTGACCTGTGGGAAGGGATGGGG + Intronic
1119857004 14:77908395-77908417 GGGACAAGGGGGATGGGAGGGGG - Intronic
1119899542 14:78248303-78248325 GTGGCGGGTGGGGGGGGGGGGGG - Intronic
1120984525 14:90322321-90322343 GTGACAGGTGGGAGGAGGGGAGG - Intronic
1121485699 14:94312781-94312803 GTGCGGGATGGGAGGGGAGGTGG + Intronic
1121592398 14:95125753-95125775 GGGAGGAGGGGGAGGGGAGGGGG + Intronic
1121816986 14:96936127-96936149 GTGACGAGGGAGAAGGGAGGTGG - Intergenic
1122075100 14:99230776-99230798 GTGAGGTGTGTGAGGGGTGGGGG - Intronic
1122107918 14:99473287-99473309 GTGGGCAGTGGGAGCGGAGGTGG + Intronic
1122125055 14:99574462-99574484 GTGAGGAGTGAGTGGGGATGGGG - Intronic
1122324233 14:100873255-100873277 GTGACGCATGGGTGGAGAGGGGG - Intergenic
1122469732 14:101958110-101958132 GTGAGGAGAGGCAGGTGAGGGGG - Intergenic
1122835090 14:104426947-104426969 GAGAGGGGTGGGCGGGGAGGAGG - Intergenic
1122937932 14:104968411-104968433 GGGCCGAGCGGGAGGGGAGAAGG + Intronic
1123476489 15:20595155-20595177 GTGGAGTGTGGGAGGGGTGGAGG + Intergenic
1123641522 15:22405209-22405231 GTGGAGTGTGGGAGGGGTGGAGG - Intergenic
1123725947 15:23101494-23101516 GGGGCCAGTGGGAGTGGAGGAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124109504 15:26773083-26773105 GGGCGGAGGGGGAGGGGAGGAGG + Intronic
1125241950 15:37586137-37586159 GTGACTAATTGCAGGGGAGGTGG - Intergenic
1125576502 15:40759254-40759276 GTGGCATGTGGGAGGTGAGGTGG + Intergenic
1125762613 15:42107285-42107307 GCGACGGGTGGGCGGGGGGGGGG + Intergenic
1126300137 15:47185181-47185203 GTGACGACTTGGAGGAGTGGGGG + Intronic
1126439595 15:48673176-48673198 GTGACCTGGGGGAGGGGATGAGG - Intergenic
1126866986 15:52947618-52947640 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1127050722 15:55080875-55080897 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
1127058807 15:55161081-55161103 GTGAGGTGAGGGAGGGGATGGGG + Intergenic
1127500888 15:59553310-59553332 GAGACGAGAGGGAGGGGGGATGG - Intergenic
1127507599 15:59610971-59610993 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507616 15:59610998-59611020 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127507623 15:59611009-59611031 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1127625923 15:60780067-60780089 GTGGGGAGAGGGTGGGGAGGAGG + Intronic
1127649750 15:60995480-60995502 GGGAGGAAGGGGAGGGGAGGAGG - Intronic
1128326008 15:66724784-66724806 ATGACGAGTGAGATGGCAGGTGG + Intronic
1128783229 15:70376538-70376560 AGGAAGAGAGGGAGGGGAGGAGG + Intergenic
1128940888 15:71786797-71786819 GGGAGGAGGAGGAGGGGAGGAGG + Intergenic
1129383124 15:75180411-75180433 GTGGAGAGTGGAAGAGGAGGGGG + Intergenic
1129516280 15:76159531-76159553 GTGAGGACTGGCAGGGGAGCTGG - Intronic
1130508783 15:84571018-84571040 GGGACGAGAGGGACGGGAGCGGG - Intergenic
1130625259 15:85507817-85507839 CTGATGTGTGGGAGTGGAGGAGG - Intronic
1130903091 15:88221747-88221769 GTGACGGGTGAATGGGGAGGTGG + Intronic
1131036636 15:89226852-89226874 GTGACTCTTGGGAAGGGAGGAGG - Intergenic
1131263900 15:90904412-90904434 GCGGGGGGTGGGAGGGGAGGCGG - Intronic
1132052211 15:98616487-98616509 GGCACGGATGGGAGGGGAGGAGG + Intergenic
1132243135 15:100276075-100276097 GTGCCTGGTGGGAGGGTAGGAGG + Intronic
1132243148 15:100276108-100276130 GTGCCTGGTGGGAGGGTAGGAGG + Intronic
1132243161 15:100276141-100276163 GTGCCTGGTGGGAGGGTAGGAGG + Intronic
1132451251 15:101969733-101969755 GTGACGACTGGCAGTGGAGTGGG + Intergenic
1132516085 16:366654-366676 GTGGCGAGTGGTAGAGGAGGTGG - Intergenic
1132873513 16:2125820-2125842 GTGAAGGGTGGGAGTGGAGAGGG - Intronic
1133020959 16:2966796-2966818 GTGAGGAGTGGGCGGGGACCAGG + Intronic
1133270530 16:4609057-4609079 CTGACGAGGGGGTGGGGAGGAGG + Exonic
1133463014 16:6003468-6003490 GGGCCGGGTGGGAGGGGTGGTGG - Intergenic
1133520281 16:6549525-6549547 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
1133744501 16:8676029-8676051 GTGACCTGGGGGTGGGGAGGGGG + Intronic
1133937076 16:10277953-10277975 GTGAGGAGTGGGTGGGGTAGGGG - Intergenic
1134088177 16:11372856-11372878 GAGATGAGTGGGAGTGGATGGGG - Intronic
1134152591 16:11816835-11816857 GTGACTGGTGGGAAGGGAGAGGG - Intergenic
1134167352 16:11941343-11941365 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1134449313 16:14353997-14354019 GGGAGGAGGGGGAGGGAAGGAGG + Intergenic
1134493342 16:14712338-14712360 TTGGGGAGGGGGAGGGGAGGGGG - Intronic
1134498723 16:14751462-14751484 TTGGGGAGGGGGAGGGGAGGGGG - Intronic
1134525277 16:14938092-14938114 TTGGGGAGGGGGAGGGGAGGGGG - Intronic
1134552601 16:15144998-15145020 GTGAAGGGTGGGAGTGGAGAGGG - Intergenic
1134581850 16:15377623-15377645 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1134712865 16:16336576-16336598 TTGGGGAGGGGGAGGGGAGGGGG - Intergenic
1134720724 16:16379883-16379905 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1134720731 16:16379894-16379916 TTGGGGAGGGGGAGGGGAGGGGG - Intronic
1134839905 16:17393448-17393470 GTGAAGAGTGGGAGGGTGGTTGG - Intronic
1134946696 16:18331991-18332013 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1134946703 16:18332002-18332024 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1134953955 16:18372106-18372128 TTGGGGAGGGGGAGGGGAGGGGG + Intergenic
1134953962 16:18372117-18372139 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1135066548 16:19314926-19314948 GGGATGAGTGGAGGGGGAGGAGG + Intronic
1135192552 16:20366832-20366854 GGGAGGATTGGGAGGGGACGGGG - Intronic
1135365699 16:21851260-21851282 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1135365706 16:21851271-21851293 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1135973019 16:27086020-27086042 GTGGAGGGTGGGAGGGGAGCAGG + Intergenic
1136137175 16:28263555-28263577 GTGACAAGAGGCAGGGCAGGAGG + Intergenic
1136194817 16:28644467-28644489 TTGGGGAGGGGGAGGGGAGGGGG - Intronic
1136275868 16:29179303-29179325 TAGCCCAGTGGGAGGGGAGGTGG - Intergenic
1136309455 16:29397744-29397766 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1136322896 16:29499499-29499521 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1136377245 16:29872751-29872773 GAGAGGAGGGGGAGGGGATGGGG + Intronic
1136437580 16:30239467-30239489 TTGGGGAGGGGGAGGGGAGGGGG + Intronic
1136617941 16:31410199-31410221 GTGGAGAGTGAGAGGAGAGGGGG + Intronic
1137401224 16:48155849-48155871 AGGATGAGAGGGAGGGGAGGAGG + Intronic
1137744431 16:50810353-50810375 ATGACGAGTGGGAGGAGGGCAGG + Intergenic
1137862919 16:51864899-51864921 GGGGAAAGTGGGAGGGGAGGAGG + Intergenic
1137990638 16:53151215-53151237 GAGAGGAAAGGGAGGGGAGGGGG - Intronic
1138037583 16:53624762-53624784 GAGACGAGGGGGAGGGGGAGGGG - Intronic
1138340697 16:56287178-56287200 GGGAAGAGTGGGAGGTGAAGAGG + Intronic
1138372437 16:56538015-56538037 GTGAGGACTGGGATGGGAGGGGG - Intergenic
1138618085 16:58188038-58188060 GTGGGGAAGGGGAGGGGAGGGGG + Intronic
1138703706 16:58892641-58892663 GTGATGAGTGGTAGTGGTGGTGG - Intergenic
1139088643 16:63617851-63617873 GTGGCAAGTGGGTGGGGCGGTGG + Intergenic
1139271332 16:65686143-65686165 GAGAGGAATGGAAGGGGAGGAGG + Intergenic
1139286951 16:65823941-65823963 TTGATGTGTGGGAGAGGAGGTGG - Intergenic
1140365538 16:74377806-74377828 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365545 16:74377817-74377839 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365552 16:74377828-74377850 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365559 16:74377839-74377861 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1140365566 16:74377850-74377872 TTGGGGAGGGGGAGGGGAGGGGG - Intergenic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141436815 16:84004350-84004372 GTGACATGTGGGAGGGGAACAGG - Intergenic
1141763974 16:86046588-86046610 GTGGGAAGTGGCAGGGGAGGGGG + Intergenic
1141782466 16:86172619-86172641 GTGAAGAGTGGGAGGGGAGATGG - Intergenic
1141989716 16:87602863-87602885 GAGGGGAGGGGGAGGGGAGGAGG - Intronic
1142007000 16:87694105-87694127 GAGACCACAGGGAGGGGAGGTGG + Intronic
1142080240 16:88145365-88145387 TAGCCCAGTGGGAGGGGAGGTGG - Intergenic
1142183999 16:88685928-88685950 GTGGTGGGTGGGAGGGAAGGAGG - Intronic
1142248800 16:88981775-88981797 GTGGTGAGTGGAAGGCGAGGGGG + Intergenic
1142355975 16:89602242-89602264 GTGATGAGTCGTAGGGCAGGAGG + Intergenic
1142752308 17:1996381-1996403 GGGCCGGGGGGGAGGGGAGGTGG - Intronic
1142762761 17:2051328-2051350 GAGGCGACCGGGAGGGGAGGAGG + Intergenic
1142977901 17:3656280-3656302 GTGAGGACTGGCAGGGGTGGAGG - Intronic
1142977961 17:3656430-3656452 GTGAAGACTGGCAGGGGTGGAGG - Intronic
1143391390 17:6561173-6561195 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391400 17:6561196-6561218 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143391526 17:6561648-6561670 AAGAGGAGGGGGAGGGGAGGAGG - Intergenic
1143572082 17:7765643-7765665 GCGAGAACTGGGAGGGGAGGAGG + Intronic
1143590863 17:7885278-7885300 GTGCGGCGGGGGAGGGGAGGAGG - Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143620090 17:8075747-8075769 CTGAGGAGTGGGAGGGGAGGAGG - Intronic
1143704493 17:8687444-8687466 GGGAGGACGGGGAGGGGAGGGGG - Intergenic
1144448369 17:15353115-15353137 GTGCAGAGTGGGAGAGGGGGAGG - Intergenic
1144625823 17:16844030-16844052 TAGAAGAGAGGGAGGGGAGGCGG - Intergenic
1144668592 17:17118617-17118639 GTGACGACTGGGAAGGGGGAAGG + Intronic
1146128700 17:30251086-30251108 TGGAAGAGTGGGAGGGGTGGAGG + Intronic
1146162984 17:30569955-30569977 TAGAAGAGAGGGAGGGGAGGCGG - Intergenic
1146504416 17:33392602-33392624 GTGACAGGAGAGAGGGGAGGAGG - Intronic
1146581305 17:34040437-34040459 GGGAGGAGGGGGAGGGGACGAGG + Intronic
1146645181 17:34572502-34572524 GAGAAGAAAGGGAGGGGAGGAGG - Intergenic
1147165011 17:38588491-38588513 AGGCCGAGCGGGAGGGGAGGAGG + Intronic
1147168294 17:38604770-38604792 GGGGTGCGTGGGAGGGGAGGGGG + Intronic
1147250304 17:39149301-39149323 GTGACCAGTGGAAGGGCAGCTGG - Intronic
1147610223 17:41797635-41797657 GCAAGGAGTGGGAAGGGAGGGGG - Intergenic
1147994433 17:44353378-44353400 GTGAGGGCTGGGAAGGGAGGGGG - Exonic
1148018648 17:44539627-44539649 GTGGCAAGTGGGAAAGGAGGAGG + Intergenic
1148439260 17:47703199-47703221 GAGAGGGGTGGGGGGGGAGGTGG - Intronic
1148955506 17:51350579-51350601 GTCACAACTGGGTGGGGAGGAGG + Intergenic
1148974084 17:51511598-51511620 GGGAAGAGTGGGAGGGGGTGAGG - Intergenic
1149614640 17:57987981-57988003 GAGCCGGGAGGGAGGGGAGGAGG + Intronic
1149626495 17:58083860-58083882 GCGCCGAGAGGGAGGGGCGGCGG - Intronic
1149659912 17:58328843-58328865 TTGGTGGGTGGGAGGGGAGGAGG - Intergenic
1149796927 17:59529467-59529489 GTGATGGGGGGGTGGGGAGGAGG - Intergenic
1150221374 17:63497492-63497514 TGGAGGACTGGGAGGGGAGGGGG - Intronic
1150364863 17:64573221-64573243 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
1150693619 17:67385483-67385505 GTGCCTGGGGGGAGGGGAGGGGG - Intronic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151354269 17:73549225-73549247 GAGAGGAGTGGGAAGAGAGGAGG + Intronic
1151535577 17:74737187-74737209 GGGAGGAGTGGGCGGGGCGGGGG + Intronic
1151544523 17:74784611-74784633 GGGAGGATTGGCAGGGGAGGAGG + Intronic
1151606797 17:75142625-75142647 GGGAGGGGAGGGAGGGGAGGGGG + Intronic
1151620016 17:75239766-75239788 GTAATGAGTGGGAGGAGATGTGG - Intronic
1152049412 17:77960053-77960075 GTGCCGGGAGGTAGGGGAGGAGG + Intergenic
1152083951 17:78205894-78205916 CTGAGCAGTGGGAGGGGAGGTGG - Intronic
1152701031 17:81819888-81819910 GTGAGGAGGGGGAGGGGACGCGG - Intergenic
1152701041 17:81819911-81819933 GTGAGGAGGGGGAGGGGATTGGG - Intergenic
1153149400 18:2073596-2073618 GTAACAAATGGGAGTGGAGGGGG + Intergenic
1153223533 18:2881404-2881426 GTGTAGAGTGGGAGGGGTGGGGG + Intronic
1153259586 18:3210364-3210386 GTGACACGTGGGAGTGGGGGTGG + Intronic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1153922406 18:9803556-9803578 GTGATGATTGTGTGGGGAGGAGG + Intronic
1153985650 18:10348634-10348656 GTGAGGAGTGGGAAGGGGAGGGG + Intergenic
1154956654 18:21264663-21264685 GTGACCAGGAGGGGGGGAGGGGG - Intronic
1155141447 18:23048279-23048301 GTGAAGAGTTGGTGGGGAGTGGG - Intergenic
1156149508 18:34224936-34224958 GAGGGGAGTGGGAGGGGTGGGGG - Intronic
1156291771 18:35754136-35754158 CTGATGAGTGGGAGAGGATGGGG + Intergenic
1156492763 18:37506059-37506081 GTTGGGGGTGGGAGGGGAGGGGG - Intronic
1156547953 18:37984427-37984449 GTGAGAAGGGGGTGGGGAGGCGG + Intergenic
1157031514 18:43915272-43915294 GTGAGAAGGGGGAGGGGAGCAGG - Intergenic
1157529578 18:48409659-48409681 GTGGCGAGTGGGCGGCGCGGCGG + Intronic
1157801708 18:50626615-50626637 ATGAGGAATGGGAGGGGAGAGGG - Intronic
1158308972 18:56138749-56138771 GGGATGAGTGGGAAGGGAGTGGG + Intergenic
1158551701 18:58441551-58441573 GTGGAGAGAGGGAGGCGAGGTGG + Intergenic
1158589179 18:58765381-58765403 CTCAGGAGTGGGAGGGTAGGAGG - Intergenic
1158652003 18:59296679-59296701 GTGAGGGGTGGGAGGGGTGGAGG - Exonic
1159623526 18:70667359-70667381 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1160019278 18:75167817-75167839 GTGAGGACTGGGAGGGGCAGGGG - Intergenic
1160634013 19:62814-62836 GTGACGACTGGCAGTGGAGTGGG - Intergenic
1160872207 19:1282557-1282579 GAGGAGGGTGGGAGGGGAGGAGG + Intergenic
1160975417 19:1790278-1790300 GAGGGGAGAGGGAGGGGAGGGGG - Intronic
1161194143 19:2977056-2977078 GTGAGGAGTGGGAGGTGGGTGGG - Intergenic
1161264413 19:3357835-3357857 GAGACGGGTGGGAGGGGGGAGGG + Intergenic
1161266243 19:3366082-3366104 GTGATGGGGGGGTGGGGAGGGGG + Intronic
1161307876 19:3577598-3577620 GTGACGGGGGCGTGGGGAGGTGG - Intronic
1161404592 19:4084383-4084405 GCGAGGAGTGGGAGGGAGGGAGG - Intergenic
1161415637 19:4145174-4145196 GAGAGGAGAGGAAGGGGAGGAGG + Intergenic
1161437514 19:4272759-4272781 GTGGGGTGTGAGAGGGGAGGAGG - Intergenic
1161438783 19:4279231-4279253 GGGACGCGGCGGAGGGGAGGTGG + Exonic
1161492139 19:4567885-4567907 GTGATGAGTGGGAGAGAGGGAGG - Intergenic
1161623198 19:5310051-5310073 GTGAGGAGGGGGAGGAGGGGAGG - Intronic
1161649880 19:5477945-5477967 GTGAGGAGGGGGAGAGGAGGGGG - Intergenic
1161657182 19:5523444-5523466 GTGAAGAGTGGGAGAGAGGGAGG - Intergenic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161993178 19:7696990-7697012 GTGAGGCTTGGGAGGGGATGGGG - Intronic
1162018148 19:7856707-7856729 CTGGAGAGTGGGAGAGGAGGGGG - Intronic
1162024271 19:7884696-7884718 ATGGGGAGGGGGAGGGGAGGAGG + Intergenic
1162269625 19:9603629-9603651 GGGAGGGGGGGGAGGGGAGGGGG + Intergenic
1162485990 19:10960937-10960959 GTGCTGAGGGGGAGGGGAGCCGG + Intergenic
1162671305 19:12260021-12260043 GTAAAGAGTGGGAGTGGAGGGGG - Intronic
1162798771 19:13099782-13099804 GTGTCTAGCGGGAGGGCAGGAGG - Intronic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1163632812 19:18425819-18425841 GTGACATCAGGGAGGGGAGGCGG - Intronic
1163779552 19:19239383-19239405 GGGAGGAGTGGGAGGGAAGATGG - Intronic
1163784536 19:19267941-19267963 GAGACTGGTGGCAGGGGAGGGGG + Intronic
1164364635 19:27563068-27563090 GTGGGGTGGGGGAGGGGAGGGGG + Intergenic
1164742423 19:30585753-30585775 ATGACGGGTAGGAGGGCAGGAGG - Intronic
1164743572 19:30594719-30594741 GAGAAGAGTGGGGAGGGAGGAGG - Intronic
1165730445 19:38141491-38141513 GTGAGGAGAGGGAGGGGCGGAGG - Intronic
1166120829 19:40685204-40685226 GTGTGGAGTGGGTGTGGAGGTGG + Intronic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166205056 19:41264338-41264360 GGCACGAGTGAGGGGGGAGGCGG + Exonic
1166288602 19:41847659-41847681 ATGAGGTCTGGGAGGGGAGGAGG + Intronic
1166538673 19:43592007-43592029 GTGAGGAGTGGGAGGGGGCTTGG - Exonic
1166773428 19:45298101-45298123 GTGAGGGGTGACAGGGGAGGAGG - Intronic
1166786614 19:45370924-45370946 GAGACGAGGTGGAGGGGCGGGGG - Intergenic
1166856419 19:45784548-45784570 GGTAAGGGTGGGAGGGGAGGGGG + Intronic
1166882838 19:45939783-45939805 GTCAGGAGTTGGGGGGGAGGAGG + Exonic
1166886948 19:45967453-45967475 GTGAAGAGTGGGATGGGAATGGG - Intronic
1167322336 19:48804948-48804970 GTCCAGAGTGGGAGGGGAGAGGG + Intronic
1167538997 19:50073524-50073546 GTGAGGGGTGGGAGGTGGGGAGG + Intergenic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167792678 19:51691077-51691099 CTGAGGAGGGGGAGGAGAGGCGG - Intergenic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168257255 19:55173711-55173733 GAGAGGAGCGTGAGGGGAGGAGG + Intronic
1168328773 19:55553894-55553916 GGGAGGGGTGGGAGGGAAGGAGG - Intergenic
1168357845 19:55713580-55713602 GAGAGGAGGAGGAGGGGAGGAGG - Intronic
1168389309 19:55993373-55993395 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
1168389314 19:55993384-55993406 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
1168389319 19:55993395-55993417 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
1168389324 19:55993406-55993428 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
1168389329 19:55993417-55993439 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
1168389334 19:55993428-55993450 GAGAGGAGGGGGAGAGGAGGGGG - Intergenic
925174284 2:1771334-1771356 GTGAGGCGTGGGTTGGGAGGAGG - Intergenic
925347795 2:3183011-3183033 GTGAGGGGTGGGTGGGTAGGTGG - Intergenic
925418389 2:3690296-3690318 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
926098058 2:10095413-10095435 GTGCGGGATGGGAGGGGAGGTGG + Intergenic
926404496 2:12537141-12537163 GTGAAGAATGGGAAGGGAGAGGG + Intergenic
926683556 2:15681101-15681123 GGGGGGAGGGGGAGGGGAGGGGG + Intergenic
926683572 2:15681125-15681147 GGGGGGAGGGGGAGGGGAGGGGG + Intergenic
926915473 2:17887258-17887280 GGGAAGAGTGGGAGTGGGGGAGG - Intronic
927507074 2:23621542-23621564 GAGATGAGGGGGAGGGGAGGGGG + Intronic
927698371 2:25252314-25252336 GGGGCCACTGGGAGGGGAGGGGG + Intronic
928108456 2:28488196-28488218 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
928278394 2:29922029-29922051 GGGGGGAGTGGGAAGGGAGGAGG + Intergenic
928363574 2:30684954-30684976 GTGGGGAGGGGGAAGGGAGGAGG + Intergenic
928498676 2:31863341-31863363 GGAAAGAGAGGGAGGGGAGGGGG + Intergenic
929051619 2:37841843-37841865 GGGAAGAGTGGAAGGCGAGGAGG + Intergenic
929113474 2:38424898-38424920 GTGACCAGTGAGAGAAGAGGAGG + Intergenic
929298113 2:40271247-40271269 GAGAGGAGTGGGAGGGGAGGTGG - Intronic
929817587 2:45247310-45247332 GTGCTGGGGGGGAGGGGAGGGGG - Intergenic
930046429 2:47176612-47176634 GAGAAGAGTTTGAGGGGAGGGGG - Intergenic
930639564 2:53840665-53840687 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
930826327 2:55700298-55700320 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
931634121 2:64326715-64326737 GAGGTGAGTGGGCGGGGAGGGGG + Intergenic
932010902 2:67976495-67976517 GTCAGGGGTGGGAGGGGAGATGG + Intergenic
932336705 2:70935809-70935831 AGGAGGAGAGGGAGGGGAGGGGG + Intergenic
933667020 2:84971722-84971744 GGGCGGAGGGGGAGGGGAGGCGG + Intronic
933685359 2:85136966-85136988 GATACGAGTGGGGAGGGAGGAGG + Intronic
933940352 2:87239862-87239884 GTGAGGAGAGAGAGAGGAGGAGG - Intergenic
934953656 2:98597851-98597873 GTGGAGAGTTGGAGGGGTGGTGG + Intergenic
934979864 2:98830892-98830914 GAGACCTGTGGGATGGGAGGAGG + Intronic
935292217 2:101620402-101620424 GGGGCGAGTGGTAGGGGAGGTGG - Intergenic
935308407 2:101759659-101759681 ATGGGGAGGGGGAGGGGAGGGGG - Intronic
935671387 2:105559871-105559893 GTGGAGGGTGGGAGTGGAGGTGG - Intergenic
936352786 2:111725914-111725936 GTGAGGAGAGAGAGAGGAGGAGG + Intergenic
936525395 2:113237760-113237782 GTGACGAGTGTGAAGGTATGTGG - Intronic
936567467 2:113592214-113592236 GTGACGACTGGCAGTGGAGTGGG + Intergenic
936679400 2:114753067-114753089 ATGAGGAGGGGAAGGGGAGGAGG + Intronic
936919718 2:117675503-117675525 GTGTGGAGTGGCGGGGGAGGTGG - Intergenic
937060830 2:118979362-118979384 CTGACTGCTGGGAGGGGAGGAGG + Intronic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
938114081 2:128591567-128591589 GAGATGAGTGGGAGGGGTAGGGG + Intergenic
938240501 2:129739199-129739221 GGGATGAGTTGGAGAGGAGGTGG - Intergenic
939166841 2:138649474-138649496 GAGAGGAGTGGGAGAGGATGAGG - Intergenic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
939739409 2:145887214-145887236 TTGACCAGTGGGTGGGCAGGAGG - Intergenic
940721486 2:157287423-157287445 GGGATGAGAGGGAGGGGAGAGGG - Intronic
940856294 2:158730902-158730924 GTGAGGAGTGAGAGGCCAGGGGG - Intergenic
940964285 2:159820530-159820552 GGGAAGAGTGGGAGGGGATGAGG + Intronic
941287421 2:163631510-163631532 GAGAGAAGTGGGAGGGGAGCTGG - Intronic
941686912 2:168456637-168456659 GTGCGCAGGGGGAGGGGAGGAGG - Intronic
941809191 2:169738871-169738893 GGGAGGAGAGGGAGGGGAAGGGG - Intronic
942206000 2:173620513-173620535 GACAGGAGTGGGAGGGGAGGTGG + Intergenic
942607672 2:177709631-177709653 GTGAAGAGTGAGAGAGGAAGAGG + Intronic
942799483 2:179860444-179860466 GGGACGAGGAGAAGGGGAGGGGG - Intronic
942940119 2:181606411-181606433 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
942940157 2:181606492-181606514 GAGACGAGGGGGAGGGGAGGGGG + Intronic
942940176 2:181606530-181606552 GAGAGGAGGGGGAGGGGAGGGGG + Intronic
943060551 2:183038181-183038203 GTCGCGGGCGGGAGGGGAGGAGG - Exonic
943128628 2:183828263-183828285 GTCCCGAGTGGGAGAGGATGGGG - Intergenic
944155015 2:196598526-196598548 GAGAGGAGGGGGAGGGGATGGGG + Intergenic
944225335 2:197343843-197343865 AAGAAGAGTGGGAGGGAAGGAGG + Intergenic
944505927 2:200410640-200410662 GAGATGGGTGGGAGGGGAAGGGG - Intronic
945694577 2:213086777-213086799 GTGTGGAATGGGAGTGGAGGGGG + Intronic
945747104 2:213731638-213731660 GGGACGTGTTGGAGGGCAGGGGG - Intronic
945955517 2:216082425-216082447 GTGGGGAGTGGGAGGTGAGACGG - Intronic
945958278 2:216106334-216106356 GTGGCGGGTGGGAGCGGCGGAGG + Intergenic
946010506 2:216560177-216560199 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
946015881 2:216603349-216603371 GAGAGGAAGGGGAGGGGAGGAGG + Intergenic
946093150 2:217248541-217248563 TTGAAGAGGGGAAGGGGAGGGGG - Intergenic
946471966 2:219968993-219969015 GGGGCGTGTGGGAGGTGAGGGGG - Intergenic
946578781 2:221104412-221104434 GAGGGGAGTGGGAGGAGAGGAGG - Intergenic
947162884 2:227231938-227231960 GTGAAGGGTTGGATGGGAGGTGG - Intronic
947834518 2:233166067-233166089 GGGACGAGTGGGGGTGGACGCGG - Intronic
948279152 2:236733208-236733230 CTGAAAAGTGGCAGGGGAGGAGG - Intergenic
948483324 2:238264021-238264043 GTGAAAAGAAGGAGGGGAGGAGG + Intronic
948983199 2:241505488-241505510 CTGAAGAGTCGGAGGGGTGGTGG - Intronic
1168761021 20:349521-349543 GTCTCGAGTGGGAGGAGAAGCGG + Intronic
1168772746 20:426331-426353 GTGAGGCGTGGCAGGGGAGTGGG - Intronic
1168842241 20:916906-916928 GAGAGCAGAGGGAGGGGAGGAGG + Intergenic
1168937969 20:1684003-1684025 GTTACCAGGGGCAGGGGAGGGGG + Intergenic
1168983163 20:2025018-2025040 GTTAGGAGTGGGGGGTGAGGTGG - Intergenic
1169018512 20:2310927-2310949 TTCAGGAGTGGGAGGAGAGGAGG + Intronic
1169023642 20:2349044-2349066 GTGCCGGGTGGGTGGGGAGGGGG + Intergenic
1169164105 20:3407661-3407683 GTGCCGGGTGGGAGGGGGCGCGG + Intergenic
1169483670 20:6007704-6007726 GGGAAGAGTGGGAGGGGAGAAGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170554887 20:17506901-17506923 GCCACGGGTGGGAGTGGAGGAGG + Intronic
1171411988 20:24953671-24953693 ATGCGGGGTGGGAGGGGAGGTGG - Intronic
1171973175 20:31577177-31577199 CTGAAGTGCGGGAGGGGAGGTGG + Intronic
1172299069 20:33835844-33835866 GTGGCGAGAGAGAGAGGAGGAGG + Intronic
1172762019 20:37329551-37329573 GGAAAGAGTGGGAGGAGAGGTGG - Intergenic
1173716918 20:45216159-45216181 GGGAAGAGTGGGAGGGGGGCGGG + Intergenic
1173775739 20:45704778-45704800 GTGGTGATTGGGAGGGGAGGAGG - Intronic
1173821248 20:46021925-46021947 GGGACGAGGGGGAGGGGCCGGGG + Intronic
1173826878 20:46053471-46053493 GTGAGGAGTGGGTGGGAAGAGGG + Intronic
1173966861 20:47119117-47119139 GTGAGTAGTTGGAGGGGAGACGG - Intronic
1174117586 20:48237907-48237929 GTGGGGAGTGGCAGGGGTGGAGG - Intergenic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174163926 20:48571240-48571262 GTGGGGAGTGGCAGGGGCGGAGG + Intergenic
1174398202 20:50260855-50260877 GTGACTAGGTGGTGGGGAGGTGG + Intergenic
1174818529 20:53707847-53707869 CTGACCAGTGGGAAGGAAGGTGG + Intergenic
1175336047 20:58197073-58197095 GGGTGGAGTGGGAGAGGAGGAGG - Intergenic
1175336065 20:58197121-58197143 GGGCAGAGTGGGAGAGGAGGAGG - Intergenic
1175404708 20:58718566-58718588 GGCCCGAATGGGAGGGGAGGTGG - Intronic
1175422103 20:58840974-58840996 GGGGCGAGTGGGAAGAGAGGAGG + Intronic
1175619025 20:60427677-60427699 GTGAGGAGCAGGAGGGAAGGAGG - Intergenic
1175625217 20:60484003-60484025 GTGGGGAGGGGGAGGGGAGGGGG - Intergenic
1175726499 20:61322240-61322262 GTGGGGAGTTGGAGGGGATGGGG - Intronic
1175730967 20:61353688-61353710 GGGAGGAGGAGGAGGGGAGGAGG - Intronic
1175774993 20:61647577-61647599 GTGAGGAGAGAGAGGAGAGGGGG - Intronic
1175788344 20:61725778-61725800 GGGAGGGCTGGGAGGGGAGGTGG + Intronic
1175943403 20:62548092-62548114 GAGACGGGAGGGAGGGGAGAGGG - Intergenic
1176018934 20:62952892-62952914 GTGGCGGGGGTGAGGGGAGGGGG + Intronic
1176085582 20:63294129-63294151 GAGCGGAGTGTGAGGGGAGGGGG + Intronic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176263114 20:64193657-64193679 GTGAAGAGTGGGGGGTGAGGAGG - Intronic
1177557381 21:22709798-22709820 GTGAAGAGTGGGAGGAGGGTGGG + Intergenic
1177994925 21:28085287-28085309 GGGAAGAGTGGGAGGGGACAAGG - Intergenic
1178059945 21:28841666-28841688 GGGAAGAGTGGGAGGGGATGAGG + Intergenic
1178259668 21:31087477-31087499 GAGAGGAGGAGGAGGGGAGGAGG - Intergenic
1178305821 21:31489383-31489405 AGGAGGAGAGGGAGGGGAGGGGG + Intronic
1178363864 21:31972193-31972215 GGAACTGGTGGGAGGGGAGGAGG + Intronic
1178386141 21:32152066-32152088 GTGGCATGGGGGAGGGGAGGTGG + Intergenic
1178708162 21:34890592-34890614 GTGCCCAGGGGGAGCGGAGGCGG - Intronic
1179135784 21:38678848-38678870 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1179714530 21:43280410-43280432 GAGGGGAGTTGGAGGGGAGGTGG + Intergenic
1179714551 21:43280460-43280482 GAGGGGAGTTGGAGGGGAGGTGG + Intergenic
1179729697 21:43360850-43360872 GGGAAGGGTGGGAGGGGAGGTGG - Intergenic
1179999262 21:44987713-44987735 GTGAGGAGTGGGAGGGAATTGGG - Intergenic
1180058856 21:45374562-45374584 ATGAGGAGGGGCAGGGGAGGAGG - Intergenic
1180159172 21:45991412-45991434 GTGGCGAGTGGGCGGGAGGGTGG + Intronic
1180230397 21:46423774-46423796 ATGAGGAGGGGGAGGGGAGGAGG + Intronic
1180230408 21:46423803-46423825 AGGGGGAGTGGGAGGGGAGGAGG + Intronic
1180318058 22:11294254-11294276 GTGAGGTGTGGGAGGGGGGAAGG + Intergenic
1180787154 22:18553488-18553510 GTGGGGGGTGTGAGGGGAGGGGG + Intergenic
1180872510 22:19154600-19154622 GAGGTGAGGGGGAGGGGAGGGGG - Intergenic
1180941678 22:19663707-19663729 GAGACCACAGGGAGGGGAGGAGG - Intergenic
1180977601 22:19857388-19857410 GTTGCGAGTGGGAGGGGAAGAGG - Intergenic
1181133978 22:20751526-20751548 GTGTCGAGTTGGGGGTGAGGGGG - Intronic
1181234586 22:21441818-21441840 GTGGGGGGTGTGAGGGGAGGGGG - Intronic
1181244063 22:21493013-21493035 GTGGGGGGTGTGAGGGGAGGGGG + Intergenic
1181282236 22:21728211-21728233 TGGCCGAGTGGGAGCGGAGGTGG - Intronic
1181359446 22:22323391-22323413 GTGAGGAGAGTGATGGGAGGAGG - Intergenic
1181369532 22:22405134-22405156 GTGAGGAGAGTGATGGGAGGAGG - Intergenic
1181448532 22:23000055-23000077 ATGAGGTTTGGGAGGGGAGGGGG - Intergenic
1181555529 22:23669511-23669533 GGGAAGAGTAGAAGGGGAGGGGG + Intergenic
1182453539 22:30435268-30435290 GGGAGGAGAGGGAGGGGAGAAGG - Intergenic
1182586272 22:31345936-31345958 CTGGCGGGCGGGAGGGGAGGTGG - Exonic
1182679836 22:32070229-32070251 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1182823836 22:33244828-33244850 GTAAGGAGGGGGAGGGGAAGTGG + Intronic
1183008736 22:34927043-34927065 GAGAAAAGTGGGAGGGTAGGAGG + Intergenic
1183108354 22:35630339-35630361 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183352230 22:37340698-37340720 GTGGCGGGTGGGCGGAGAGGCGG + Intergenic
1183385414 22:37511397-37511419 GTGAGGAGGAGGAGGGGAGGAGG + Intronic
1183418427 22:37696309-37696331 GTGGCGACTGGGATGGGAGGAGG - Intronic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1184379495 22:44136223-44136245 GAGACCAGAGGGTGGGGAGGAGG + Intronic
1184488091 22:44793337-44793359 GTGGTGAGTGGCAGGGGAGAGGG + Intronic
1184600234 22:45539119-45539141 GAGGGAAGTGGGAGGGGAGGGGG - Intronic
1184661548 22:45967703-45967725 GTGGTGGGTGGGAGGGGAAGGGG + Intronic
1184663852 22:45977395-45977417 GTGACGAGTGGTGGGGGTGCGGG + Intergenic
1184933710 22:47702223-47702245 GAGAGGAGGGGGAGGGGAGGGGG - Intergenic
1185149528 22:49156124-49156146 GTGCAGAGTGGGAGGGGCTGTGG - Intergenic
1185173786 22:49307715-49307737 GTGAAGATGGGGAGGGGAGGAGG + Intergenic
1185418957 22:50724602-50724624 GTGCTGAGAGTGAGGGGAGGGGG + Intergenic
950016340 3:9757412-9757434 GTGAGGAGTGGTAGGGAAGCAGG + Exonic
950188624 3:10960824-10960846 GTGGAGTGTGGCAGGGGAGGGGG + Intergenic
950459854 3:13114877-13114899 GTGAAGATTTGGAGAGGAGGTGG + Intergenic
950465803 3:13153097-13153119 GAGAGGAGAGGGAGGGGAGAGGG - Intergenic
950475292 3:13210914-13210936 AGGCCGAGTGGGAGGCGAGGAGG + Intergenic
950584062 3:13880325-13880347 GTGACGGGTGGGGGGCGAGCGGG - Intergenic
950591869 3:13942000-13942022 GGGAAGAGTGGGAGGGGGCGGGG - Intronic
950718391 3:14865543-14865565 GAGATGAGTGAGAGGGGAAGGGG - Intronic
951455421 3:22886768-22886790 GTGGTGTGTGTGAGGGGAGGTGG - Intergenic
951760582 3:26143251-26143273 GTGGGGTGTTGGAGGGGAGGTGG + Intergenic
951902351 3:27669371-27669393 GAGTAGGGTGGGAGGGGAGGTGG - Intergenic
952038272 3:29230740-29230762 GTAAGGAGAGGGAGGGAAGGAGG - Intergenic
952167657 3:30768565-30768587 GTGGGGAGGGGGAGGAGAGGCGG + Intronic
952703658 3:36353316-36353338 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
952942195 3:38453822-38453844 GCGGGGAGGGGGAGGGGAGGCGG - Intergenic
953531988 3:43747404-43747426 GGGACGAGAGGCAGGAGAGGAGG + Intergenic
953771370 3:45780610-45780632 GTGAGGAGGCGGTGGGGAGGGGG + Intronic
954349389 3:50030160-50030182 GTGACTGGTGGGTGGGGCGGGGG + Intronic
954364540 3:50139041-50139063 GTGAATAGGGGGAGGGGAAGGGG + Intergenic
954390224 3:50264784-50264806 GGGAGGAGTGGGAGGAGAGGGGG - Intergenic
955220625 3:57020296-57020318 TTCACAAGTGAGAGGGGAGGTGG - Intronic
955550727 3:60082119-60082141 GGGACTAGTGGGAGGGAAGGAGG - Intronic
955596317 3:60594604-60594626 GAGAGGAGAGGGAAGGGAGGAGG - Intronic
955735741 3:62036440-62036462 GTGTGGAGTGGCAGGAGAGGTGG - Intronic
957040060 3:75329562-75329584 GAGGGGAGCGGGAGGGGAGGGGG + Intergenic
957534535 3:81484614-81484636 GTTGCGAGTAGGAGGGGAAGAGG + Intergenic
958044662 3:88268726-88268748 GTGAGGAGTGGGATGGCAGAGGG + Intergenic
958947074 3:100375390-100375412 CTGAAGAGTAGGAGGTGAGGGGG - Intronic
959436665 3:106323442-106323464 GGGAAGAGTGGGAGGGGCGAGGG + Intergenic
960067872 3:113394305-113394327 GTGGTGAGTGGGAGGGGAGTAGG - Intronic
960747836 3:120908855-120908877 GAGATGAGGGGGAGGTGAGGGGG + Intronic
961067180 3:123885020-123885042 GGGAGGGGGGGGAGGGGAGGGGG + Intergenic
961384417 3:126516055-126516077 GTGAGGAGGGGGTGGGTAGGTGG - Intronic
961384452 3:126516149-126516171 GTGAGGAGGGGGTGGGTAGGTGG - Intronic
961384487 3:126516243-126516265 GTGATGAGGGGGTGGGTAGGTGG - Intronic
961384525 3:126516342-126516364 GGGACGAGGGGGAAGGTAGGTGG - Intronic
961384549 3:126516406-126516428 GTGATGAGGGTGAGGGTAGGTGG - Intronic
961384560 3:126516440-126516462 GTGATGAGGGGGAGGGTAGGTGG - Intronic
961752388 3:129104542-129104564 TTGCTGAGTGGGAGAGGAGGGGG - Intronic
961788170 3:129359944-129359966 AGGCCGAGTGGGAGGTGAGGAGG - Intergenic
962072257 3:132044786-132044808 GAGGAGAGGGGGAGGGGAGGGGG + Intronic
962331924 3:134485993-134486015 GTGATGCGGGGGAGGGGGGGGGG - Exonic
962403506 3:135081092-135081114 GTGAAGGAGGGGAGGGGAGGTGG + Intronic
962487097 3:135854408-135854430 GGGAAGAGTGGGAGGGGACAAGG - Intergenic
962679484 3:137783781-137783803 GTGAGGAGGAGGAGGAGAGGTGG - Intergenic
962758711 3:138488489-138488511 GAGACGAGGGGGAGGGGGAGGGG + Intergenic
962787781 3:138784415-138784437 GAGACGAGAGGGAGAGGGGGAGG - Intronic
963271460 3:143289802-143289824 GCTATGAATGGGAGGGGAGGTGG - Intronic
963343416 3:144065534-144065556 GGGACGAGGGTGAGGGGATGGGG + Intergenic
963742982 3:149097968-149097990 GGGAGGAGGGGGAGGGGAGGGGG + Intergenic
965111216 3:164425953-164425975 GGGAAGAGTGGGAGGGGGGAGGG - Intergenic
965223314 3:165955221-165955243 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
965480401 3:169211904-169211926 GTGAGGAGTGTGCAGGGAGGAGG - Intronic
965594855 3:170400561-170400583 AGGAGGAGAGGGAGGGGAGGGGG - Intergenic
965638159 3:170805661-170805683 GGGAAGAGTGGGAGGGGGTGAGG + Intronic
966125188 3:176568258-176568280 GCAGCGAGTGGGTGGGGAGGGGG - Intergenic
966220854 3:177549631-177549653 GTTATGAGTGGGGGGGGGGGGGG + Intergenic
966815260 3:183885023-183885045 CTGAGCAGTGGGAGGGGAAGCGG - Intergenic
966886287 3:184379781-184379803 GCGAAGAGGGGGAGGAGAGGCGG - Intronic
967277391 3:187789936-187789958 GGGAGGGGAGGGAGGGGAGGAGG + Intergenic
967836514 3:193968753-193968775 GGGCCTAGTGGGAGGTGAGGTGG - Intergenic
967836522 3:193968775-193968797 GGGCCTAGTGGGAGGTGAGGTGG - Intergenic
967947890 3:194818565-194818587 GCTTCGAGTGGGAGGTGAGGGGG - Intergenic
967987702 3:195107551-195107573 GGGAAGAGGGGGAGAGGAGGAGG + Intronic
968155155 3:196374879-196374901 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
968889213 4:3359013-3359035 AGGAAGAGGGGGAGGGGAGGAGG - Intronic
968952003 4:3700212-3700234 GGGAGGAGTGGAGGGGGAGGGGG + Intergenic
969370351 4:6727714-6727736 GGGAGGAAGGGGAGGGGAGGGGG - Intergenic
969370365 4:6727740-6727762 GGGAGGAGGGGCAGGGGAGGTGG - Intergenic
969580164 4:8060149-8060171 GTATCCAGTGGCAGGGGAGGAGG - Intronic
969843417 4:9900572-9900594 GTGAGGACTGGGTGGGGATGAGG - Intronic
970410716 4:15805433-15805455 GTCAAGAGTGAGGGGGGAGGAGG - Intronic
971420289 4:26468062-26468084 GAGAGGAATGGGAAGGGAGGGGG + Intergenic
971691323 4:29840411-29840433 GTGGGTAGTGGGAGAGGAGGAGG - Intergenic
971784651 4:31084767-31084789 GGGAGGAGGGGGAGGGGACGGGG + Intronic
971854867 4:32030253-32030275 GTGTGGAGTGGGAGGAGAGTTGG - Intergenic
971859032 4:32080243-32080265 GTCAGGAGAGAGAGGGGAGGAGG + Intergenic
972162981 4:36247595-36247617 GTGAGGAGGAGGAGGAGAGGAGG - Intergenic
972741350 4:41889721-41889743 GTGGCAAGTGGAAGGGGAGCAGG - Intergenic
972793838 4:42397699-42397721 TTGAGGAGTGGGGAGGGAGGTGG + Intergenic
973663950 4:53138863-53138885 GAGACGAGAGGGAGGGGGAGGGG - Intronic
973779138 4:54271969-54271991 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
974833397 4:67216430-67216452 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
975281472 4:72568044-72568066 GTGCAGAGGGGGAGGGGAGAAGG + Intronic
975460882 4:74651318-74651340 GGGAGGAGGGGGAGGGGAGGGGG + Intergenic
975776079 4:77789002-77789024 GTGATGTGTGGAAGGGGAGTTGG - Intronic
976158491 4:82173395-82173417 GACAGGAGTGGGAGGTGAGGTGG + Intergenic
977006941 4:91579372-91579394 GTACTGAGTGGGAGGGGAGGGGG - Intronic
978165644 4:105603387-105603409 GTGAGGAGAGGTAAGGGAGGGGG + Intronic
978369785 4:108018605-108018627 GGGGCGGGTGGGAGGAGAGGAGG - Intronic
978427143 4:108594407-108594429 GTGAAGAGTGGGCGGGGTAGGGG + Intergenic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979583103 4:122383226-122383248 TTGGGGAGTGGGAGAGGAGGTGG - Intronic
979788520 4:124748618-124748640 GGGAAGAGAGGGAGGGAAGGAGG + Intergenic
980248513 4:130280843-130280865 CAGAAGAGTGGGAGGGTAGGAGG - Intergenic
981025077 4:140069558-140069580 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
981034097 4:140152601-140152623 GTCACGACTGCGAGGGGCGGAGG - Intronic
981550383 4:145936974-145936996 GTGACGGGGAGGAGGGGACGCGG - Intronic
982107629 4:152024542-152024564 GAGATGAGTGGGCAGGGAGGAGG - Intergenic
984070388 4:175103527-175103549 GGGAGGAGTGGGAGGGGGAGGGG + Intergenic
984596644 4:181676516-181676538 GAGAGGAGAGGGAGAGGAGGGGG - Intergenic
985621997 5:960696-960718 GTGAGTTGTGGGTGGGGAGGAGG - Intergenic
985976012 5:3419614-3419636 GTGAGGGGTGGGAGGTGTGGGGG + Intergenic
986276665 5:6281254-6281276 GTGACCTGTGGGGTGGGAGGAGG - Intergenic
986291863 5:6406604-6406626 CTGAGGAGTGGGGGGGGTGGGGG - Intergenic
986628286 5:9743818-9743840 GTGAGGAGGAGGAGGAGAGGAGG + Intergenic
986881343 5:12175669-12175691 ATGAGGGGTGGGAGGTGAGGGGG - Intergenic
987288671 5:16487327-16487349 CTGGCGAGAGGGAGGGGAGATGG - Intronic
987361503 5:17111520-17111542 GGGGGGAGGGGGAGGGGAGGGGG - Intronic
987896102 5:23949399-23949421 AGGAGGAGTGGGAGGGGAAGGGG - Intergenic
988091992 5:26554863-26554885 GAGAGGAGGGGGAGTGGAGGGGG + Intergenic
988783018 5:34540812-34540834 TTGAGGAGTGGGAGTGGAGGAGG - Intergenic
988801174 5:34698111-34698133 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
989102953 5:37837809-37837831 GTGACGCGTGGAAGGGGTGAGGG - Intronic
989588183 5:43089140-43089162 GAGACGAGAGGGAGGGGGAGGGG + Intronic
990312469 5:54553055-54553077 GAGAAGGGTGGGAGGGGATGGGG + Intergenic
990719420 5:58676594-58676616 GTGCGGGGTGGTAGGGGAGGTGG + Intronic
990787170 5:59434711-59434733 GTGGGGAGAGGGAGTGGAGGAGG - Intronic
991018344 5:61955247-61955269 GTGGAGAATGGGTGGGGAGGTGG - Intergenic
992415999 5:76551885-76551907 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
992578983 5:78151852-78151874 GAGAGGAGGGGGAGGGGAAGGGG - Intronic
992884957 5:81149476-81149498 AGGAAGGGTGGGAGGGGAGGAGG + Intronic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
995809844 5:116093360-116093382 CTGAGGAGAGGGAGGAGAGGTGG + Intronic
995818251 5:116196345-116196367 GTGAAGAGAGGGAGGGGGTGAGG + Intronic
996237655 5:121152049-121152071 GTTGAGAGTGGGAGGGGAGCAGG - Intergenic
996382768 5:122878562-122878584 GAGAAGAGTGGAAGTGGAGGTGG + Intronic
996581325 5:125035207-125035229 TGGAAGAGTGGGATGGGAGGAGG - Intergenic
996700461 5:126445619-126445641 GTGGGGAGTGGGGGGTGAGGAGG + Intronic
996788284 5:127265059-127265081 GTGGTGAGGGGGAAGGGAGGAGG - Intergenic
996856726 5:128016536-128016558 GGGAGGAAAGGGAGGGGAGGGGG - Intergenic
996978085 5:129459516-129459538 TTGAGGAGTGGGATGGGAAGGGG + Intergenic
996982331 5:129513919-129513941 GTGAGGAGTTTGAGGGGAGGTGG - Intronic
997225752 5:132208390-132208412 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997225759 5:132208401-132208423 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
997305017 5:132830487-132830509 GTGAAGAGCGGGCGGCGAGGCGG - Intronic
997363597 5:133311326-133311348 TTGACTAGTGGGCGGGGAGGAGG + Intronic
997565933 5:134886443-134886465 TTGATGAGTTGGAGGGCAGGAGG + Intronic
997587093 5:135049844-135049866 GGGACGGGTGGGAAGAGAGGGGG + Intronic
997737953 5:136228278-136228300 GTCAAGAGTGGGTGGGGTGGGGG + Intronic
998797768 5:145837125-145837147 GTGAGGAGTGGGAGTTGGGGAGG + Intergenic
998798068 5:145839973-145839995 GTGAGGAGTGGGAGTTGGGGAGG - Intergenic
998836086 5:146203879-146203901 GGGGCGTGGGGGAGGGGAGGTGG + Intronic
999242826 5:150137477-150137499 GTGATGAAAGGGATGGGAGGAGG + Intronic
999881238 5:155866826-155866848 GTAAGGAAAGGGAGGGGAGGAGG - Intergenic
1000294523 5:159901434-159901456 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1001279783 5:170378591-170378613 TGGAAGAGTGGGAGGGCAGGTGG + Exonic
1001625873 5:173132473-173132495 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1002042286 5:176523490-176523512 GGGGGGAGGGGGAGGGGAGGAGG - Intergenic
1002327615 5:178420345-178420367 GAGAGGAGGGGCAGGGGAGGAGG - Intronic
1002327681 5:178420510-178420532 GTGAGGAGGGGGAGGAGAGGAGG - Intronic
1002327729 5:178420644-178420666 GAGAGGAGGGGCAGGGGAGGAGG - Intronic
1002473939 5:179453386-179453408 GTGATGGGTGGGAGGGTGGGAGG - Intergenic
1002473954 5:179453428-179453450 GTGACGGGTGGGAGGGTGGGAGG - Intergenic
1002590856 5:180291286-180291308 GAGAGGAGTGCGCGGGGAGGCGG + Intronic
1003109198 6:3239420-3239442 CTGCTGAGTGGGAGGTGAGGGGG + Intronic
1003460260 6:6322069-6322091 GTGATGAAGGGGAGGAGAGGAGG - Intergenic
1003843436 6:10147029-10147051 GGGGCGAGTGGGAGGAGATGGGG - Intronic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1004070236 6:12291212-12291234 GTGGCGGGGGGGGGGGGAGGCGG - Intronic
1005069684 6:21851756-21851778 GTGAGGAGAGGGAGGTGGGGGGG - Intergenic
1005959908 6:30687202-30687224 GAGACTGGAGGGAGGGGAGGAGG + Exonic
1005980280 6:30831241-30831263 CTGGGGAGTGGGAGGGGAGGAGG - Intergenic
1006009627 6:31031656-31031678 GGGAAGAGTGGGAGGGGGCGAGG - Intronic
1006445718 6:34078715-34078737 GTGACAAGTAAGAGGAGAGGAGG - Intronic
1006641127 6:35490333-35490355 CTGGTGAGGGGGAGGGGAGGGGG + Intronic
1006680768 6:35795533-35795555 GTGACCAGTGAGATGGGTGGGGG - Intronic
1006717084 6:36127578-36127600 GTCATGAAAGGGAGGGGAGGAGG - Intergenic
1006800729 6:36758045-36758067 GAGGTGAGTGTGAGGGGAGGAGG + Intronic
1006851578 6:37102505-37102527 GTGGAGACTGGGTGGGGAGGGGG + Intergenic
1006923479 6:37641084-37641106 AGGCAGAGTGGGAGGGGAGGAGG - Intronic
1007502255 6:42307293-42307315 CAGAGGAGTGTGAGGGGAGGAGG - Intronic
1007724736 6:43908480-43908502 GTGCAGAGTGAGAGGAGAGGTGG + Intergenic
1007768746 6:44177003-44177025 GTGAGGGGTGAGAGGGGAGGGGG + Intronic
1008160354 6:48068733-48068755 GCGCGGAGTGGGTGGGGAGGCGG - Intergenic
1008947949 6:57119648-57119670 TGGAGGGGTGGGAGGGGAGGAGG - Intronic
1009322550 6:62310094-62310116 GGGAAGAGTGGGAGGGGTGAAGG + Intergenic
1009465712 6:63966360-63966382 GGGAAGAGTGGGAGGGGGTGAGG + Intronic
1010168140 6:72941427-72941449 ATGAAGAGAGGGAGGGAAGGAGG - Intronic
1010567199 6:77430734-77430756 GTGATGAGTGGTAGCGGTGGTGG + Intergenic
1010934877 6:81849424-81849446 GTGACCATGGTGAGGGGAGGAGG + Intergenic
1011127116 6:84019540-84019562 GTGGCGAGGAGGTGGGGAGGGGG + Intergenic
1011132617 6:84067026-84067048 GTGACGAGAAGGAGGGGGTGAGG - Intronic
1011366865 6:86591903-86591925 GTGCCAAGTGGGAGGGGTGTGGG + Intergenic
1011366877 6:86591947-86591969 GTGCCGAGTGGGAGGGGTGGTGG + Intergenic
1011410245 6:87059762-87059784 GGGGGGAGGGGGAGGGGAGGCGG + Intergenic
1012170911 6:96015935-96015957 GAGGCGAGGGGGAGGGGAGGAGG - Intergenic
1012252207 6:96991846-96991868 GTGAGGAGTAGCAGGGGCGGGGG + Intronic
1014166091 6:118226711-118226733 GAGAGGAGTGGTAGGGGATGAGG + Intronic
1014935498 6:127380517-127380539 TTGACGGGGGGGAGGTGAGGTGG - Intergenic
1015204077 6:130615408-130615430 CTGACAAGAAGGAGGGGAGGAGG + Intergenic
1015227471 6:130873858-130873880 GTGAGGAGGGTGAGGGGAGTAGG + Intronic
1015446532 6:133312063-133312085 GTGATGAGTGGGAGTACAGGAGG + Intronic
1016318878 6:142820332-142820354 TGGAAGAGAGGGAGGGGAGGTGG - Intronic
1017047717 6:150363279-150363301 GAGACTAGGGGAAGGGGAGGAGG - Intergenic
1017198029 6:151723219-151723241 CTGAGGGGTGGGAGGGGAAGAGG + Intronic
1017281374 6:152629532-152629554 GGGGGGAGGGGGAGGGGAGGAGG + Intronic
1017542656 6:155418568-155418590 GCGGGGAGTGGAAGGGGAGGGGG - Intronic
1017758069 6:157546472-157546494 GAGAGGAGTAGGTGGGGAGGAGG + Intronic
1017809358 6:157973807-157973829 CTGACAAGTGGGAGAGGAAGAGG - Intergenic
1017889637 6:158627823-158627845 GTGGCATGTGGGAGGTGAGGTGG + Intronic
1018152322 6:160951788-160951810 GTTAGGAGTGGAAGGGGAGATGG + Intergenic
1018167845 6:161116202-161116224 GTGAGGGGTGGGTCGGGAGGTGG + Intronic
1018647569 6:165962307-165962329 GTGACCAGTGGGTGGGAATGAGG + Intronic
1018678191 6:166241260-166241282 GTGAGAAGTGGGAGGAGAGTGGG + Intergenic
1019060536 6:169254678-169254700 CTGAGGTGTGGGAGGGGCGGGGG - Intergenic
1019223508 6:170493269-170493291 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223526 6:170493315-170493337 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223537 6:170493342-170493364 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223548 6:170493369-170493391 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223580 6:170493462-170493484 GTGAGGAGGGGAAGAGGAGGAGG + Intergenic
1019228921 6:170540921-170540943 GTGCAGAGGGGTAGGGGAGGAGG + Intronic
1019419253 7:943045-943067 GAGACGAGGAGGAAGGGAGGAGG + Intronic
1019508325 7:1404711-1404733 GTGAGGAGGGGGAGTGGAAGAGG + Intergenic
1019508348 7:1404790-1404812 GGGAGGAGTGGGAGGAGGGGAGG + Intergenic
1019794023 7:3036485-3036507 GTAACGACTGGGAGGGGATATGG + Intronic
1020092736 7:5350372-5350394 GGGAGGTCTGGGAGGGGAGGCGG + Intronic
1020100042 7:5389372-5389394 GGCAGGGGTGGGAGGGGAGGTGG - Intronic
1021167896 7:17362545-17362567 GTGAGGAGTGGGCGGGGTAGGGG + Intergenic
1021272515 7:18608281-18608303 GAGAGGAGTGGGAGGGGAGGGGG + Intronic
1022087162 7:27079733-27079755 GTGAGGGATGGGAGGGGAAGGGG - Intergenic
1022472766 7:30691853-30691875 GTGATGGGTGGGCAGGGAGGAGG + Intronic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1023527462 7:41119539-41119561 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1023550953 7:41369580-41369602 GTGAGGAGTGGGTGGCGTGGGGG - Intergenic
1023735178 7:43229479-43229501 GTGGAGAGTGGGAGGGGGAGGGG + Intronic
1024288117 7:47777930-47777952 GTGAGGAGCTGCAGGGGAGGTGG + Intronic
1024345687 7:48310770-48310792 GTGGAGAGTGGGAAGTGAGGAGG + Intronic
1024603659 7:51008284-51008306 GTGAGCAGTGAGAGGGGAGCGGG - Intergenic
1025806784 7:64839978-64840000 GTGAGGAGTGGGCGGGGTAGGGG + Intergenic
1025814068 7:64893688-64893710 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1025945060 7:66099106-66099128 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1025945107 7:66099267-66099289 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1025945141 7:66099356-66099378 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1025945167 7:66099436-66099458 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1026040744 7:66865910-66865932 GTGAGGGGAGGGAAGGGAGGAGG - Intergenic
1026285017 7:68955268-68955290 GAGGGGAGAGGGAGGGGAGGGGG + Intergenic
1026447112 7:70494566-70494588 GTGTCGGGGGGGAGGGGCGGTGG - Intronic
1026461892 7:70621582-70621604 TTGAGGGGTGGGAGGGTAGGAGG + Intronic
1026554465 7:71394220-71394242 GTGGAGAGAGAGAGGGGAGGAGG + Intronic
1026936589 7:74260037-74260059 GGGACGGGTGGGAGTGGGGGTGG + Intergenic
1027349848 7:77300283-77300305 GGGAAGAGTGGGAGGGGGCGAGG - Intronic
1027658636 7:80962296-80962318 GTGAAGAGGGGGTGGGGCGGGGG + Intergenic
1027753810 7:82185484-82185506 AGGAGGAGGGGGAGGGGAGGGGG + Intronic
1028182459 7:87742347-87742369 GGGAAGAGTGGGAGGGGGTGAGG - Intronic
1029139509 7:98400453-98400475 GTGTCGAGGGGCAGGGGAGGAGG + Intronic
1029152933 7:98493738-98493760 GGGAAGAGTGGGAGGGGTCGAGG - Intergenic
1029535331 7:101154525-101154547 GTGCGAAGAGGGAGGGGAGGGGG + Intronic
1029667899 7:102007692-102007714 GTGGCGAGGGAGGGGGGAGGAGG - Intronic
1030658323 7:112192268-112192290 GGGACAAGGGGGAGGGGAGGGGG + Intronic
1031895843 7:127347377-127347399 GTGGCGGGGGGGTGGGGAGGTGG + Intronic
1031992562 7:128207731-128207753 GAGGGGAGTGGGGGGGGAGGTGG - Intergenic
1032037488 7:128531239-128531261 GAGAGGAGGGGGAGGGGACGAGG - Intergenic
1032078145 7:128845833-128845855 TTGGGGAGTGGGAGAGGAGGGGG + Intronic
1032096612 7:128941334-128941356 GTGTCCAGTGGGAGGAGAAGGGG + Intronic
1032182279 7:129690547-129690569 GTGAGGGGTGGGAGGTGAGGAGG + Intronic
1032438436 7:131921620-131921642 GTGACGTGGGGGAATGGAGGAGG - Intergenic
1032479497 7:132235141-132235163 GAGAGGAATGGAAGGGGAGGGGG + Intronic
1032512132 7:132480731-132480753 GTGGCCACAGGGAGGGGAGGAGG - Intronic
1033120857 7:138665102-138665124 GTGGCGAGTGGGGGCGGGGGAGG - Intronic
1033344740 7:140518241-140518263 ATGAGGACTGTGAGGGGAGGAGG - Intergenic
1033354933 7:140591967-140591989 GAGAGGAGGGAGAGGGGAGGGGG - Intronic
1033628972 7:143138965-143138987 GAGAAGAGTGGGGGTGGAGGTGG - Intronic
1033683792 7:143620942-143620964 GGGACGGGTCGGAGGCGAGGCGG - Exonic
1033700820 7:143836696-143836718 GGGACGTGTCGGAGGCGAGGCGG + Intergenic
1033705473 7:143882117-143882139 GTGACGTCTGAGAAGGGAGGGGG + Intronic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1033969837 7:147025447-147025469 GGGAGGAGGGGGAGGGGAGGAGG + Intronic
1034216762 7:149413526-149413548 GGGAGGAGGGGGAGGGGGGGAGG + Intergenic
1034254068 7:149714914-149714936 GGGCCGAGGGGGAGGGGCGGGGG - Intronic
1034628692 7:152514056-152514078 GTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1034734318 7:153413973-153413995 GTGAGGAGTGGGTGGGGTAGGGG + Intergenic
1035413524 7:158665662-158665684 CTGACAAGGGGGAGGGAAGGTGG - Intronic
1035555658 8:565497-565519 AGGACGAGAGGGAGGGGAGGTGG - Intergenic
1035559478 8:593879-593901 GTGAGGAGAGGGATGTGAGGGGG + Intergenic
1036621232 8:10425440-10425462 GGGAGGAGGAGGAGGGGAGGTGG + Intronic
1037217925 8:16480327-16480349 TTGGGAAGTGGGAGGGGAGGGGG + Intronic
1037313668 8:17581330-17581352 GTGATGCGTGGGACGGGAGCTGG + Intronic
1037467265 8:19172650-19172672 GAGAGGAGAGGGAGGGGAGGGGG + Intergenic
1037624659 8:20596306-20596328 GTGCTGAGTGGGTGGGGAGCAGG + Intergenic
1037713276 8:21373088-21373110 GGGAAGAGTGGGAGGGGTTGAGG - Intergenic
1037900968 8:22689520-22689542 GGAAGGAGTGGGAGGGCAGGGGG + Exonic
1037967776 8:23147139-23147161 GAGCTGAGTGGGAGGGGATGGGG - Intronic
1038399989 8:27277356-27277378 GGGAGGAGAGAGAGGGGAGGGGG - Intergenic
1038476935 8:27875202-27875224 GTGAAGAGAGGGAGGGAGGGAGG - Intronic
1038517412 8:28199198-28199220 GGGATGAGTGGGAGTGGAGCAGG + Intergenic
1039187153 8:34930362-34930384 GGAAAGAGTGGGAGGGAAGGAGG + Intergenic
1039542110 8:38381527-38381549 GTGGGGAGTGGGATGGGAGTCGG - Intronic
1039908800 8:41807954-41807976 GGGAAGAGGAGGAGGGGAGGAGG + Intronic
1039944929 8:42120834-42120856 GGGGCGAGTGAGAGGGGAGCTGG - Intergenic
1040079777 8:43274934-43274956 GGGAGGAGGAGGAGGGGAGGAGG - Intergenic
1041267610 8:56080339-56080361 AGGAGGAGGGGGAGGGGAGGAGG + Intergenic
1041378969 8:57232172-57232194 GTGTCGGGTGGGTTGGGAGGAGG - Intergenic
1041743052 8:61177068-61177090 GTGGCGAGGGGGCGGGGCGGGGG + Intronic
1042026926 8:64433644-64433666 CTGATCAGTGGCAGGGGAGGAGG + Intergenic
1042692252 8:71513737-71513759 GTGAGGAGCTGGAGAGGAGGTGG - Intronic
1042730733 8:71931378-71931400 GGGAAGAGTGGTAGGGGAGGAGG + Intronic
1043507245 8:80914708-80914730 GGGAGGAGTGCGAGGGAAGGGGG - Intergenic
1044591311 8:93916841-93916863 GTGACGAGTGGGAGGGGAGGCGG - Intronic
1044744096 8:95355524-95355546 GTGACCAGAGGGAAGGGAAGAGG - Intergenic
1044932048 8:97260180-97260202 GAGGGGAGGGGGAGGGGAGGGGG + Intergenic
1045105544 8:98889008-98889030 GTTTGTAGTGGGAGGGGAGGAGG - Intronic
1045124313 8:99072477-99072499 TTGAGGAGTGGGAGAGGAGAGGG - Intronic
1045233422 8:100328114-100328136 GTGAGGAGTGGGTGGAGAGTGGG - Intronic
1045591390 8:103602444-103602466 GTGAAGAGTGGGAGGAGGGATGG - Intronic
1045708098 8:104950737-104950759 TTGAGGAGTGGGTGGGGAGGGGG - Intronic
1046323226 8:112605617-112605639 GTGAAGGGTGGGAGGGCAGAGGG + Intronic
1047998493 8:130358291-130358313 GCGGCGAGAGGGAGGGAAGGAGG + Intronic
1048420932 8:134277712-134277734 GTGAGCAGCGGGAGTGGAGGTGG + Intergenic
1048570084 8:135645139-135645161 GTGAAGAGAGGGAGGAGAGATGG + Intronic
1048681454 8:136845996-136846018 GAAAAGAGTGGGAGGGGATGAGG + Intergenic
1048900821 8:139036203-139036225 GAGATGAGAGGGAGGGCAGGTGG + Intergenic
1048976395 8:139675223-139675245 GAAAAGGGTGGGAGGGGAGGAGG + Intronic
1049271905 8:141700521-141700543 GGGAAGAGGGGAAGGGGAGGGGG + Intergenic
1049362395 8:142218513-142218535 GTGGTGAGTGGGATGAGAGGGGG - Intronic
1049363500 8:142225396-142225418 GTTAGGAGAGGCAGGGGAGGTGG - Intronic
1049452625 8:142670167-142670189 GGGAGGCGTGGGAGGGGAGAAGG + Intronic
1049485494 8:142856998-142857020 GGGGGGAGGGGGAGGGGAGGGGG + Intronic
1049547975 8:143243388-143243410 GGGATGAGGGGGAGGGGAGGAGG + Intergenic
1049598148 8:143494081-143494103 CTGGGGAGTGGGAGGGGAAGGGG + Intronic
1049612597 8:143562372-143562394 GTGGCGGGTGGGAGGGAGGGAGG + Intronic
1049630031 8:143648846-143648868 GTCACCAGTGGGGAGGGAGGAGG + Intronic
1049745795 8:144262801-144262823 GTGAGGGGTGGGGGGGGGGGCGG - Intronic
1049885067 9:21319-21341 GTGACGACTGGCAGTGGAGTGGG - Intergenic
1049987175 9:962360-962382 GTGAGGAGTGAGGGGAGAGGAGG + Intronic
1050024417 9:1319328-1319350 GTGAGTAGTGGGAGGAGAGAAGG + Intergenic
1051418654 9:16870274-16870296 GGGACGAGGTGGAGGGGAGTGGG - Intronic
1051459323 9:17294777-17294799 GTGAGGGGAGGGAGGGGGGGAGG + Intronic
1051893987 9:21969804-21969826 TTGGCGGGGGGGAGGGGAGGAGG + Intronic
1052387775 9:27842262-27842284 GTGAAGGGTGGGAGGAGGGGAGG + Intergenic
1052777535 9:32747817-32747839 GGGATGAGTGGGAGGGGGTGAGG - Intergenic
1053221274 9:36315319-36315341 GTCAGAAGTGTGAGGGGAGGGGG + Intergenic
1053303858 9:36970271-36970293 GTGACCAGGGAGAGGGGATGGGG + Intronic
1053321526 9:37103097-37103119 TTAACAAGTGGGAGGGGAGAGGG + Intergenic
1054850639 9:69843441-69843463 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1055841621 9:80512319-80512341 GTGATCAGTGGGTGGGGAGAGGG - Intergenic
1056175717 9:84033407-84033429 GTGGGGAGAGGTAGGGGAGGTGG - Intergenic
1057036937 9:91817856-91817878 GGGAGGAGAGGGAGGGGAAGGGG + Intronic
1057070806 9:92098301-92098323 GTGAGGAGTGGGCGGGGTAGGGG - Intronic
1057908288 9:98999113-98999135 GACAGGAGTGGGTGGGGAGGGGG + Intronic
1057991997 9:99780402-99780424 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1058375287 9:104316045-104316067 AGGAGGAGGGGGAGGGGAGGGGG - Intergenic
1060124019 9:121024267-121024289 GGGGGGAGGGGGAGGGGAGGGGG + Intronic
1060124043 9:121024307-121024329 GGGGGGAGGGGGAGGGGAGGGGG + Intronic
1060124050 9:121024318-121024340 GAGGGGAGGGGGAGGGGAGGGGG + Intronic
1060146929 9:121261128-121261150 GCCACCAGTGGGATGGGAGGGGG - Intronic
1060231387 9:121827807-121827829 GTGGGGATTGGGCGGGGAGGAGG + Intronic
1060427128 9:123515747-123515769 GTGAGGAGTGGCAGGTGTGGTGG + Intronic
1060763667 9:126276694-126276716 GTGGGGAGGGGAAGGGGAGGAGG + Intergenic
1061092293 9:128433499-128433521 TGGAGGAGTGGGAGGGGAGATGG + Intronic
1061242857 9:129384300-129384322 GTAAGGAGTGGGTGGGGAGGAGG - Intergenic
1061256370 9:129455985-129456007 GGGAGGAGAGGGAAGGGAGGGGG - Intergenic
1061390593 9:130315295-130315317 GGGAGGGGAGGGAGGGGAGGGGG - Intronic
1061390612 9:130315333-130315355 GAGGGGAGTGGGAAGGGAGGGGG - Intronic
1061393322 9:130329959-130329981 GGGAAGGGGGGGAGGGGAGGAGG - Intronic
1061419922 9:130467531-130467553 GTGCCGCGTGGTAGGGGAGGCGG + Intronic
1061485899 9:130920352-130920374 GTGAGGAGTGAGCGGGGAGCGGG - Intronic
1061503879 9:131019822-131019844 GTGAAGACTGGGAGGGGGGCGGG - Intronic
1061572602 9:131487080-131487102 GTGGAGAGGGGCAGGGGAGGTGG + Intronic
1061722503 9:132561447-132561469 GTGGCCAGTGCGTGGGGAGGGGG + Intronic
1062022178 9:134324987-134325009 GTGAAGAGGGGGAGGGGGAGAGG + Intronic
1062359669 9:136181812-136181834 GGAAGGAGAGGGAGGGGAGGAGG + Intergenic
1185502493 X:608448-608470 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185502500 X:608459-608481 GAGGGGAGGGGGAGGGGAGGGGG - Intergenic
1185581369 X:1213240-1213262 GAGGGGAGGGGGAGGGGAGGTGG - Intergenic
1185608445 X:1380464-1380486 GGGAGGAGGGGGAAGGGAGGGGG + Intronic
1185688244 X:1948195-1948217 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1185688533 X:2133734-2133756 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1185713019 X:2319232-2319254 GAGAGGAGGGGGAGGGGAGGAGG - Intronic
1185749215 X:2597196-2597218 GGGAGCAGTGGGAGGGGAGAGGG + Intergenic
1185937449 X:4274947-4274969 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1186211724 X:7256849-7256871 GAGATGAGAGGCAGGGGAGGTGG - Intronic
1186511088 X:10130231-10130253 GTGAGAAGTGTGAGGGGATGGGG + Intronic
1186576776 X:10775130-10775152 GGGAGGAGGGGGAGGGGAGATGG + Intronic
1187464243 X:19514572-19514594 GGGACTAGGGGAAGGGGAGGTGG + Intronic
1187464318 X:19514731-19514753 GGGACTAGGGGGAGGGGAGGGGG + Intronic
1187464329 X:19514751-19514773 GGGACGAGGGGGAGGGGAGGGGG + Intronic
1187464340 X:19514771-19514793 GGGACGAGGGGGAGGGGAGGGGG + Intronic
1187825896 X:23333684-23333706 GTGACGACAGAGAGAGGAGGAGG + Intergenic
1187891712 X:23942367-23942389 GGAACGAGAGGGAGGGGAGAGGG - Intergenic
1188155237 X:26733801-26733823 GTGGAGGGTGGGAGGGGAGTTGG - Intergenic
1188862000 X:35269171-35269193 GAGAAGAGTGGGAGGGGGTGAGG + Intergenic
1189927983 X:45976934-45976956 GGGAAGAGTGGGAGGGGGTGAGG + Intergenic
1190109724 X:47582258-47582280 GAGGCGGGTGGGAGAGGAGGAGG + Intronic
1190184348 X:48221755-48221777 GGGAGGGGGGGGAGGGGAGGGGG - Intronic
1190255675 X:48760664-48760686 GTGAAGGGTGAGTGGGGAGGAGG + Intergenic
1191777968 X:64838416-64838438 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1192141506 X:68650467-68650489 GGGAGGAGGAGGAGGGGAGGAGG + Intronic
1192533998 X:71912174-71912196 GGGACGTGTGAGAGGGTAGGGGG + Intergenic
1192610071 X:72559049-72559071 GTGGGGAGGGGGAGGGGGGGAGG - Intronic
1192947147 X:75976629-75976651 GGGAAGAGTGGGAGGGGGCGAGG - Intergenic
1192978298 X:76310451-76310473 GGGAAGAGTGGGAGGTGGGGAGG - Intergenic
1193521984 X:82541768-82541790 GGGAAGGGTGGGAGGGGATGAGG - Intergenic
1194361933 X:92963205-92963227 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic
1194875871 X:99187409-99187431 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1194875878 X:99187431-99187453 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1195027716 X:100894637-100894659 GGGAGGAGTGGGATGGGATGGGG + Intergenic
1195812509 X:108850243-108850265 GTGGCTGGTGGGAGGGGAGCTGG + Intergenic
1196657327 X:118232186-118232208 GAGAGGAGGAGGAGGGGAGGGGG + Intergenic
1197446031 X:126552862-126552884 GGGCCGAGTGGGAGGGGCGGAGG + Intergenic
1198369263 X:135974388-135974410 GGGCCGAGGGGGCGGGGAGGAGG + Intergenic
1198543600 X:137668259-137668281 GCTAGCAGTGGGAGGGGAGGTGG - Intergenic
1198739528 X:139826238-139826260 TTGAGAAGTGGGATGGGAGGTGG + Intronic
1198744806 X:139878873-139878895 GAGACTAGGGGGAGGGGAGGGGG + Intronic
1199728394 X:150606950-150606972 GAGGGGAGGGGGAGGGGAGGGGG - Intronic
1199992045 X:152992966-152992988 GAGAGGGGTGGGAGGTGAGGAGG + Intronic
1200022932 X:153226751-153226773 GTGATGAGAGGGAGGGGGTGTGG + Intergenic
1200670180 Y:6079421-6079443 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic
1201256350 Y:12112007-12112029 GAGAAGAGAGGGAGGGAAGGGGG - Intergenic
1201452950 Y:14136088-14136110 GTAAGGAAGGGGAGGGGAGGAGG - Intergenic
1201770720 Y:17614805-17614827 GTGAGGAGTGGGCGGGGAAGGGG - Intergenic
1201830835 Y:18291181-18291203 GTGAGGAGTGGGCGGGGAAGGGG + Intergenic