ID: 1044591312

View in Genome Browser
Species Human (GRCh38)
Location 8:93916844-93916866
Sequence GCAGTGACGAGTGGGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 401}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591312_1044591326 25 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591312_1044591324 21 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591312_1044591319 -7 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591319 8:93916860-93916882 TCACTGCGCAGCCAATCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1044591312_1044591329 27 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591312_1044591321 -3 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591312_1044591325 22 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591312_1044591323 8 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591312_1044591320 -4 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591320 8:93916863-93916885 CTGCGCAGCCAATCGGCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1044591312_1044591327 26 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591312 Original CRISPR GCAGTGACGAGTGGGAGGGG AGG (reversed) Intronic
900626464 1:3610906-3610928 GAAGGGGAGAGTGGGAGGGGGGG + Intronic
900685104 1:3943264-3943286 GCAGTCACTGGTGGGAGAGGAGG + Intergenic
901652917 1:10753360-10753382 GCAGTGACGGGTGAGGGAGGAGG - Intronic
901689553 1:10963905-10963927 GCAAGGACGAGTGAGATGGGAGG - Intronic
903212792 1:21828165-21828187 GCAGAGGCGAGTGGGTGGGTGGG + Intronic
903220884 1:21869095-21869117 GCACTGTCGGGTGGGAGTGGGGG - Intronic
903556250 1:24195794-24195816 GCAGTGAGGCGTGGTGGGGGTGG + Intergenic
904121330 1:28199931-28199953 ACAGTGATGAGTGGGTGGGTGGG - Intronic
904181340 1:28668837-28668859 ACGGTGAGGAGGGGGAGGGGTGG + Exonic
905037475 1:34927534-34927556 GCAGTGGCGGGTGGGAGATGCGG + Intronic
905198974 1:36303818-36303840 GCAGTGACAAGTGGGTGAGCCGG + Exonic
905210965 1:36373969-36373991 CCAGTGGGAAGTGGGAGGGGCGG + Intronic
905408651 1:37753716-37753738 GCAGGGGCGAGCGGGAGGAGGGG + Intronic
906240379 1:44239001-44239023 GCAGTGGGGAGAGGGAGGGTGGG - Intronic
906954234 1:50359082-50359104 CCAGTTCCCAGTGGGAGGGGCGG + Intergenic
907336040 1:53700255-53700277 GCTGTGATGAGGGGGAGGTGAGG - Intronic
907493504 1:54826077-54826099 GCAGTGGCAAGTGGGGCGGGTGG + Intronic
908477711 1:64505714-64505736 GCAGCCAAGAGGGGGAGGGGCGG - Intronic
908829254 1:68163382-68163404 GCAGGGTGGGGTGGGAGGGGCGG - Intronic
910589790 1:88918526-88918548 GCAGTGAGTAGTGGGAGCAGTGG + Intergenic
911950701 1:104170619-104170641 GCAGTGATGAGAGGGAGAGAAGG + Intergenic
912622735 1:111180288-111180310 GGAGTCAAAAGTGGGAGGGGTGG + Intronic
912879268 1:113391480-113391502 TCCTTGACGAGGGGGAGGGGTGG + Intronic
913670722 1:121095258-121095280 GGAGGGAAGAGTGGGAGGGAGGG - Intronic
914022485 1:143882683-143882705 GGAGGGAAGAGTGGGAGGGAGGG - Intergenic
914660969 1:149790625-149790647 GGAGGGAAGAGTGGGAGGGAGGG - Intronic
915169632 1:153968703-153968725 AGTGTGACGAGTGGGAGTGGGGG + Intronic
915334847 1:155135235-155135257 GCAGAGACGTGTGGGAGGCTGGG + Intergenic
915725403 1:158013781-158013803 GCAGTGGGGAATGGTAGGGGAGG - Intronic
915728031 1:158032685-158032707 GCAGTGAAAGGTGGGAGGTGGGG - Intronic
916374054 1:164132061-164132083 GAAGTGAGGATGGGGAGGGGAGG + Intergenic
917739367 1:177947701-177947723 GAGGTGAGGAGAGGGAGGGGAGG + Intronic
919811623 1:201412417-201412439 GCAGTGAGGAGGGGGCAGGGAGG - Intronic
919923786 1:202181779-202181801 GCAGAGGTGAGTGGGAGGGAAGG + Intergenic
919976077 1:202613761-202613783 GCAGTGGAGAGTGAGAGGGTGGG - Intronic
921079253 1:211725569-211725591 GCAGTGGGCAGTGGGAGGAGAGG - Intergenic
922051510 1:221994990-221995012 GCAGTAAGGAGTGGGAGGCTTGG - Intergenic
923330172 1:232916520-232916542 GAAGTGAGAATTGGGAGGGGAGG - Intergenic
924011964 1:239674972-239674994 GAAGTCAGGAGTGGGAGGGAAGG - Intronic
924501841 1:244645495-244645517 CCAGAGGCGGGTGGGAGGGGTGG - Intergenic
924606500 1:245540039-245540061 GCAGGGAAAGGTGGGAGGGGAGG - Intronic
1062978636 10:1703416-1703438 GCAGTGAGGAGGCTGAGGGGTGG + Intronic
1063695706 10:8332984-8333006 GAAGAGAAGAGGGGGAGGGGAGG - Intergenic
1066362385 10:34743880-34743902 GCAGAGAAGGGTGGCAGGGGAGG - Intronic
1066362935 10:34748534-34748556 GGAGCGAGGGGTGGGAGGGGAGG - Intronic
1067283701 10:44891974-44891996 GCAGGGACCTGTGGCAGGGGAGG - Intergenic
1067681941 10:48447005-48447027 GCAGGGAGCTGTGGGAGGGGAGG - Intronic
1069082014 10:64098612-64098634 ACAGTGACGCATGGGAGGGAGGG + Intergenic
1069580057 10:69559676-69559698 GGAGTGAGGAGGGGGAGAGGAGG + Intergenic
1071798628 10:89032523-89032545 GGACTGAGGAGAGGGAGGGGTGG - Intergenic
1072654656 10:97321303-97321325 GCAGAGCCGAGTAGGAGAGGAGG - Exonic
1072728319 10:97828378-97828400 GCTGGGACTATTGGGAGGGGAGG - Intergenic
1074288583 10:112121212-112121234 GCAGTGGCGAGTAGCAGCGGGGG - Intergenic
1075092388 10:119451024-119451046 GCAGGGACGACTGGGGGGGCTGG - Intronic
1075864672 10:125707182-125707204 GCAGGGACCTGTGGGAGAGGCGG - Intergenic
1076050366 10:127328626-127328648 GCAGGGACGAGAGGGATGGCAGG + Intronic
1076825466 10:132965157-132965179 CCAGTGAGGAGTGGGAACGGTGG - Intergenic
1076825488 10:132965259-132965281 CCAGTGAGGAGTGGGAACGGTGG - Intergenic
1076825496 10:132965292-132965314 CCAGTGAGGAGTGGGAACGGTGG - Intergenic
1076825518 10:132965394-132965416 CCAGTGAGGAGTGGGAACGGTGG - Intergenic
1076825541 10:132965496-132965518 CCAGTGAGGAGTGGGAACGGTGG - Intergenic
1077142397 11:1030368-1030390 GCAGGGAGGGGTGGGGGGGGTGG - Intronic
1077430856 11:2515435-2515457 TCGGGGACGGGTGGGAGGGGTGG - Intronic
1077442852 11:2576777-2576799 GCACTGCCCAGCGGGAGGGGTGG + Intronic
1077951351 11:6961308-6961330 CCAATGACAAGTGGTAGGGGTGG + Intronic
1078602818 11:12748731-12748753 GCAGTGGCGAGAGTGTGGGGAGG + Intronic
1080004644 11:27393928-27393950 GCACTGAAGATTGGGGGGGGGGG + Intronic
1080403193 11:31955914-31955936 GGAGTGAAGGGTGGGTGGGGCGG + Intronic
1081715562 11:45247428-45247450 GGAGTGGGGAGTGGGAGTGGGGG + Intronic
1083492955 11:63026739-63026761 GCTGCTAGGAGTGGGAGGGGAGG - Intergenic
1084122475 11:67077658-67077680 GCAGTGAAGAGGGAGAGAGGCGG - Intergenic
1084801501 11:71547205-71547227 GCCGTGAGGTGGGGGAGGGGAGG + Intronic
1086991027 11:93303892-93303914 AGAGTGCCCAGTGGGAGGGGTGG + Intergenic
1088707445 11:112476641-112476663 GCAGTGACTGGTTGGAGGAGTGG - Intergenic
1088983663 11:114887132-114887154 GCTGGGACGTGTGGGTGGGGTGG + Intergenic
1089071261 11:115701374-115701396 GCAGTGATGCGTTGGATGGGAGG + Intergenic
1089533623 11:119148160-119148182 GCAGAGACGATGGGGAGGGAAGG - Intergenic
1089667698 11:120030826-120030848 GGAGTGAAGAGTGGGGGTGGGGG - Intergenic
1089789768 11:120934253-120934275 GCACTGCTGAGTGGGAGGGAGGG + Intronic
1090095746 11:123740879-123740901 GCTGTTAGGAGTGGGAGGAGAGG + Intronic
1090359230 11:126161119-126161141 GCAGTGAAGTGTGGAAGGGGAGG - Intergenic
1091150853 11:133326855-133326877 GTAGTGACGTGTGGGTGTGGGGG + Intronic
1091273617 11:134334644-134334666 GCAGGGAGGAGTAGGAGGGAGGG - Intronic
1091316844 11:134620202-134620224 GCAGTGAAGGGAGGGAGGGAGGG + Intergenic
1091608186 12:1976512-1976534 GCAGTGAGGAATGGGAGCCGAGG - Intronic
1091917015 12:4277007-4277029 CCAGTGAGGAGGGGGAGGGGCGG - Intronic
1091931966 12:4403474-4403496 TCAGTGAGGAGTAGGAGGTGTGG - Intergenic
1092020434 12:5198037-5198059 ACAGTGAAGGGTGGGAGGAGCGG - Intergenic
1092572465 12:9739954-9739976 GCAGGGAGGTGTGGGAGGGAGGG - Intergenic
1097198955 12:57261841-57261863 CCAGTGGGAAGTGGGAGGGGGGG + Intronic
1100875411 12:98956546-98956568 GGAGTGACGGGGGGGATGGGGGG - Intronic
1101244219 12:102870029-102870051 GGAGTGGTGAGGGGGAGGGGAGG + Intronic
1102308895 12:111828485-111828507 GCAGTGAGGAATGGGAGGCAGGG + Intergenic
1102527008 12:113519665-113519687 GCAGGGCCGTGGGGGAGGGGCGG - Intergenic
1102821821 12:115915056-115915078 GCCTTGAAGAGTGGGAGGGTAGG + Intergenic
1104088231 12:125494313-125494335 CCAGTGAGGAGGGGGAGGAGGGG - Intronic
1104183333 12:126403990-126404012 GCAGAAACGAGAGTGAGGGGTGG + Intergenic
1106732260 13:32553730-32553752 GCAGGACAGAGTGGGAGGGGAGG - Intergenic
1106929326 13:34646901-34646923 GGAGTGAATAGTGGGAGGGAGGG + Intergenic
1107004956 13:35599180-35599202 GCAGGCAGAAGTGGGAGGGGTGG - Intronic
1108664403 13:52615533-52615555 GTAGTGGGGAGTTGGAGGGGAGG + Intergenic
1110412537 13:75220149-75220171 GCAGTGGGGAGTGGGGAGGGTGG + Intergenic
1112399904 13:99067513-99067535 GCAGTGACCTTTGGGAGAGGAGG - Intronic
1113736143 13:112680191-112680213 GCGGAGACGCGTGGAAGGGGAGG + Intronic
1113907557 13:113826850-113826872 GCAGGGATGGGTGGGCGGGGTGG - Intronic
1114551432 14:23534823-23534845 GCAGTGAGGTGTGAGGGGGGTGG + Exonic
1115837824 14:37428865-37428887 GCAGTGGCCAGTGAGATGGGAGG + Intronic
1115844418 14:37510883-37510905 GCAGTGAGGGGAGGGAGGGAAGG - Intronic
1115953593 14:38750111-38750133 GCAGAGAGGAGTGAGAGGCGGGG - Intergenic
1117337579 14:54767873-54767895 GCAGTGCTGAGTGAGAGTGGGGG - Intronic
1118222135 14:63864726-63864748 GTAGTGAGGACTGGGAGTGGGGG + Intronic
1118750811 14:68806866-68806888 GCAGGGACTGGTGGGAGGGAGGG + Intergenic
1118862781 14:69677617-69677639 GCAGAGGGGAGTGGGTGGGGTGG + Intronic
1118867281 14:69713373-69713395 CCAGTGACAAGAAGGAGGGGAGG - Exonic
1119348475 14:73944962-73944984 GCTGTGACCAGTGGGAAGGGAGG - Intronic
1120545272 14:85803802-85803824 GCGGGGAAGAGTGGGAGGGTGGG - Intergenic
1120984526 14:90322324-90322346 GAAGTGACAGGTGGGAGGAGGGG - Intronic
1121154958 14:91674645-91674667 GGAGTGTCGAGTGGGAAGGGAGG - Intronic
1121155871 14:91683473-91683495 GGAGTGTCGGGTGGGAAGGGAGG - Intronic
1122740167 14:103867637-103867659 GCAGTGCCGGGAGGGAGGCGGGG + Intergenic
1123033220 14:105460853-105460875 GCAGGGACGAGATGGAGGAGTGG + Exonic
1124109342 15:26772570-26772592 GCAGCGGCGGGTGGGAGTGGGGG - Intronic
1124182168 15:27486543-27486565 GCAGTGCCCACTGGGAGGGAGGG + Intronic
1124491720 15:30162089-30162111 GCAGTGGAGAGTGAGAGGGTGGG - Intergenic
1124751816 15:32376220-32376242 GCAGTGGAGAGTGAGAGGGTGGG + Intergenic
1125381459 15:39091626-39091648 GCAGTGGGGGGTGGGGGGGGTGG + Intergenic
1126145206 15:45467354-45467376 GCAGGGAAGGGTGGGAGGGAGGG - Intergenic
1126724964 15:51622694-51622716 GCAGGGACGAGGCGGAGGGAAGG - Intronic
1126849224 15:52787410-52787432 GCAGGCACGAGTTGGAGGAGGGG + Intronic
1126940187 15:53758662-53758684 GCAGTGACAATGGGAAGGGGTGG + Intronic
1127649702 15:60995109-60995131 GCAGTGGAGACTGGGAGGGTGGG + Intronic
1128292559 15:66489126-66489148 GCACTGGCTGGTGGGAGGGGTGG + Intronic
1128731360 15:70023695-70023717 GCAGTGAGGGGTGGGATGGGGGG + Intergenic
1129188810 15:73926173-73926195 GCAGAGAGGAATGGGCGGGGTGG + Intronic
1129194457 15:73955780-73955802 GAAGAGAAGAGAGGGAGGGGAGG + Intergenic
1129383121 15:75180408-75180430 GCAGTGGAGAGTGGAAGAGGAGG + Intergenic
1131288134 15:91080391-91080413 GCAGGGTGGAGCGGGAGGGGGGG - Intergenic
1132599478 16:767516-767538 GGAGGGGCGAGTGGGAGGAGGGG + Intronic
1132769364 16:1552339-1552361 ACAGAGGCGAGCGGGAGGGGTGG - Intronic
1132851147 16:2025570-2025592 GGAGAGACGAGAGGGAGAGGAGG + Intronic
1134890993 16:17841677-17841699 GTAGTAACCAGTGGGTGGGGAGG + Intergenic
1135390194 16:22086337-22086359 GAAGTGACGAGAGAGAGAGGTGG - Intronic
1136064207 16:27747756-27747778 GCTGGGAGGGGTGGGAGGGGTGG + Intronic
1137447370 16:48539980-48540002 GAAGTGGAGAGTGGGAGGTGAGG + Exonic
1137609341 16:49808650-49808672 GCAGAGGACAGTGGGAGGGGCGG + Intronic
1137726381 16:50659530-50659552 GCAGTGGCGCCTGGGCGGGGTGG + Intergenic
1138703678 16:58892521-58892543 GCAGTGGTGAGTGGTAGTGGTGG - Intergenic
1138703707 16:58892644-58892666 GGAGTGATGAGTGGTAGTGGTGG - Intergenic
1139957385 16:70699638-70699660 GCAGTGAGAAGTGGGTGGTGAGG + Intronic
1140031841 16:71345251-71345273 GGAGTGAAGACTGAGAGGGGTGG + Intergenic
1142067974 16:88073543-88073565 GCAGTGAGGAGCGGGTGGGTGGG + Intronic
1142932512 17:3299023-3299045 GCAGTAAGGAGTTGGAGGGGAGG - Intergenic
1143021256 17:3918136-3918158 GAAGGGAAGAGAGGGAGGGGAGG + Intergenic
1143496797 17:7317185-7317207 GCAGTGAGTACTGGGAGGGGTGG - Exonic
1143499231 17:7329284-7329306 GCAGGGTCGGGTGGGAGTGGGGG - Exonic
1143568514 17:7739989-7740011 GCAGCCAAGAGTGGGAGGAGTGG + Intronic
1143784415 17:9245836-9245858 GCAGAGACAAGTGGCATGGGAGG + Intergenic
1144092431 17:11869986-11870008 GCAGTGATGATTGGAAGGGAGGG + Intronic
1144447826 17:15347421-15347443 TGAGTGAGGAGTGGAAGGGGAGG + Intergenic
1144447849 17:15347506-15347528 TGAGTGAGGAGTGGAAGGGGAGG + Intergenic
1144447861 17:15347549-15347571 TGAGTGAGGAGTGGAAGGGGAGG + Intergenic
1144448370 17:15353118-15353140 GAAGTGCAGAGTGGGAGAGGGGG - Intergenic
1144451875 17:15387802-15387824 GCAGGAAAGAGTGGGAGGGAGGG + Intergenic
1144890206 17:18490018-18490040 GCAGTGGGGACTGGGAGGAGGGG + Intronic
1145142010 17:20454300-20454322 GCAGTGGGGACTGGGAGGAGGGG - Intronic
1145201738 17:20951660-20951682 GTAGTGACAAGGGGGAGGGCAGG - Intergenic
1146128699 17:30251083-30251105 GGATGGAAGAGTGGGAGGGGTGG + Intronic
1146955056 17:36932652-36932674 GCAGGGGCGTGGGGGAGGGGGGG - Intergenic
1147268071 17:39246885-39246907 GCAGTGACGATCAGGTGGGGTGG - Intergenic
1147442909 17:40458325-40458347 GCACAGAGGTGTGGGAGGGGAGG - Intergenic
1147996488 17:44362840-44362862 GCAGTGCCGGCTGGGAGGGCAGG - Intronic
1148645832 17:49219356-49219378 GCAATGACAAGGGGGTGGGGTGG + Intronic
1148885247 17:50767546-50767568 TCAGTGAAGAATGGGTGGGGAGG + Intergenic
1149027899 17:52051078-52051100 GAAATGAAGAGTGGGAAGGGAGG + Intronic
1149574199 17:57699850-57699872 CCAGAGACCTGTGGGAGGGGTGG - Intergenic
1149626496 17:58083863-58083885 GCTGCGCCGAGAGGGAGGGGCGG - Intronic
1151319093 17:73342159-73342181 GGGGTGAGGAGAGGGAGGGGAGG - Intronic
1151671434 17:75573658-75573680 GCAGGGAGGGGCGGGAGGGGCGG - Intronic
1151715339 17:75828145-75828167 GCAGAGAAGAGTGTGTGGGGGGG + Intronic
1152101497 17:78304416-78304438 CCAGGCACGAGTGGGAGGAGCGG + Intergenic
1152629237 17:81402566-81402588 GCAGTCAGCAGAGGGAGGGGCGG - Intronic
1152709108 17:81861333-81861355 GGAGAGACGGGCGGGAGGGGCGG + Intergenic
1152853104 17:82648840-82648862 GCGGGGAGGAGGGGGAGGGGCGG + Intergenic
1154291007 18:13106593-13106615 GCAGTGGTGAGTGGTAGTGGTGG - Intronic
1155388615 18:25308651-25308673 GCTGTGGCGGGTGGGGGGGGGGG - Intronic
1156149511 18:34224939-34224961 GGAGAGGGGAGTGGGAGGGGTGG - Intronic
1156252041 18:35360469-35360491 GAGGGGACCAGTGGGAGGGGAGG + Intergenic
1157027137 18:43858268-43858290 GAAGTGACAAGTGCAAGGGGTGG - Intergenic
1157338357 18:46757111-46757133 GCCGTGGGGAGGGGGAGGGGCGG + Exonic
1158652004 18:59296682-59296704 GATGTGAGGGGTGGGAGGGGTGG - Exonic
1158878556 18:61754782-61754804 GCAGGGCTGAGAGGGAGGGGAGG - Intergenic
1160254356 18:77235151-77235173 GCATTTAGGAGTGGGAGAGGAGG - Intergenic
1160543427 18:79637977-79637999 GCGGACACGAGTGGGCGGGGAGG + Intergenic
1160855491 19:1215350-1215372 GCGGTGACCAGTGGAAGTGGGGG + Intronic
1160873980 19:1288804-1288826 GCAGTCACCGGTGGGAGTGGCGG - Intronic
1160960438 19:1718485-1718507 GCAGTGGGGAGGGGGAGGGGAGG + Intergenic
1161240852 19:3222953-3222975 GCAGTGAGGAGGGGGAGAGAGGG + Intergenic
1161608824 19:5229682-5229704 GCACTGGCGGGCGGGAGGGGAGG + Exonic
1161657183 19:5523447-5523469 GGAGTGAAGAGTGGGAGAGAGGG - Intergenic
1161761036 19:6173001-6173023 GCAGTGTGGGGTGGGAGGGCAGG + Intronic
1162065184 19:8121187-8121209 GCATTGAGGAGAGGGAGGGTGGG - Intronic
1162069194 19:8143426-8143448 GCAGTGAGGTGTGGCAGGGACGG - Intronic
1162500215 19:11049130-11049152 GCAGTGTCCACTGGGAGGAGAGG + Intronic
1163034266 19:14562362-14562384 GCAGAGCCGAGTGGCAGGGCTGG + Intronic
1163110777 19:15160004-15160026 GCAGTGAAGTGAGGGAGGTGGGG + Exonic
1163473738 19:17512713-17512735 CGAGGGAAGAGTGGGAGGGGCGG + Intronic
1164232459 19:23302412-23302434 GCAGTGCCTAGTGGAAGGAGTGG - Intergenic
1164391136 19:27822310-27822332 GCAGTGTCCAGTGGGAGAAGTGG - Intergenic
1165730446 19:38141494-38141516 ATAGTGAGGAGAGGGAGGGGCGG - Intronic
1167413979 19:49360993-49361015 ACAGAGACCAGAGGGAGGGGGGG + Intronic
1167413988 19:49361016-49361038 ACAGAGACCAGAGGGAGGGGGGG + Intronic
1167748544 19:51366921-51366943 ACAGGGACATGTGGGAGGGGCGG - Intronic
1168073149 19:53963589-53963611 GCAGGGAGGAGTGGGAAGGAGGG - Intronic
1168719113 19:58545119-58545141 GCAGAGAGTAGGGGGAGGGGTGG - Intronic
925364209 2:3300387-3300409 GCACTGACGAGAAGGAGAGGGGG - Intronic
925559095 2:5168434-5168456 GCAGTGAAGAGCTGGAGTGGGGG + Intergenic
925975669 2:9140241-9140263 GCAGTAAGCAGAGGGAGGGGAGG + Intergenic
926210329 2:10864472-10864494 GCGGTGACGGGAGGGAGTGGAGG + Intergenic
927430029 2:23019651-23019673 GCAGTGAGCACTGGGAGGGCAGG - Intergenic
927486521 2:23491933-23491955 GGAAGGACGAGTGGGAGGGATGG - Intronic
927591298 2:24360316-24360338 GCTGTGACGAGCGGGAGGCGCGG - Exonic
930160820 2:48154995-48155017 GCAAGGACTAGTGGGAGGTGAGG - Intergenic
930713449 2:54571112-54571134 GCGGTGAAGAGTGGTGGGGGTGG + Intronic
931691245 2:64836592-64836614 CCTGGGAGGAGTGGGAGGGGAGG + Intergenic
931693073 2:64851796-64851818 GCAGTGGGGGGTGGGAGGGAGGG - Intergenic
932580201 2:72988393-72988415 GCAGTGGCTTGTGGGAGGAGGGG + Intronic
932763730 2:74457529-74457551 GCGGCGACCAGTGGGCGGGGAGG + Exonic
935254214 2:101294644-101294666 GGAGTGATGAATGGAAGGGGGGG - Intronic
935319019 2:101867116-101867138 GCAGACAGGAGTGGGCGGGGTGG + Intronic
936086595 2:109473723-109473745 GCAGGCAGGAGTGGGTGGGGTGG - Intronic
936982879 2:118280002-118280024 GGAGTGAAGAATGGGTGGGGGGG + Intergenic
937005694 2:118510888-118510910 GCAAGGATGAGTGGGAGGGAAGG + Intergenic
937231420 2:120400241-120400263 CCAGTGACGACTTGGAGGGTCGG - Intergenic
937320105 2:120955941-120955963 GCAGTGAGGGGTGGGAGTGGGGG + Intronic
937929537 2:127193445-127193467 GCAGTGTGGAGTGGGAAGGGGGG - Intronic
939309951 2:140463166-140463188 ACAGTGGCCAGTGGGAGGGTGGG + Intronic
939851464 2:147311201-147311223 GGAGCCACCAGTGGGAGGGGTGG - Intergenic
939969640 2:148644884-148644906 GCAGTGAGGAGGAGGAGGAGCGG + Intronic
940234790 2:151498419-151498441 GCAGTTGGGAGTGGGAAGGGAGG + Intronic
940567609 2:155387750-155387772 GCAGTGACGGATGGAAGGAGTGG - Intergenic
942273652 2:174302093-174302115 GCAGAGATGAGTTGGTGGGGAGG - Intergenic
942940154 2:181606489-181606511 GGGGAGACGAGGGGGAGGGGAGG + Intronic
944037067 2:195307911-195307933 GCGGTGGCGTGTTGGAGGGGGGG - Intergenic
944471190 2:200055313-200055335 CCAGTGAGGAGTGGTGGGGGCGG - Intergenic
945017965 2:205539746-205539768 GCAATGACCTGGGGGAGGGGTGG - Intronic
945032993 2:205682477-205682499 GCAGTGGGGAGCCGGAGGGGAGG + Intronic
945699249 2:213150499-213150521 TAAGGGACGAGGGGGAGGGGTGG - Intronic
946263143 2:218513539-218513561 GCAGAGAGGAGTGGGAGGAAGGG - Intronic
946686974 2:222280308-222280330 GGAGGGAGGAGGGGGAGGGGAGG + Intronic
947407158 2:229790525-229790547 GCAGGGAGCAGGGGGAGGGGGGG + Intronic
947644239 2:231726527-231726549 CCAGTCACGGGTGAGAGGGGTGG - Intergenic
947810506 2:233001083-233001105 GCTGTGGCCAGTGGGATGGGGGG - Intronic
947876042 2:233468906-233468928 GCAGGGAGCATTGGGAGGGGTGG + Intronic
948017708 2:234703307-234703329 GAAGTGGGGAGAGGGAGGGGAGG + Intergenic
948180208 2:235973547-235973569 GCAGTGACCAGAGAGAAGGGTGG + Intronic
948360172 2:237414247-237414269 GCAGTGAGGAGGGGGAGAGGAGG - Exonic
948509770 2:238455991-238456013 GCAGTGACAAATGGGGGAGGGGG + Intergenic
948641502 2:239378535-239378557 GCAGAGGAGAGTGGGAGGTGAGG - Intronic
1169023639 20:2349041-2349063 GCAGTGCCGGGTGGGTGGGGAGG + Intergenic
1169355505 20:4901628-4901650 GCAGCTTCCAGTGGGAGGGGAGG - Intronic
1170547203 20:17444672-17444694 CCAGTGATGAATGGGAGGTGTGG + Intronic
1170683507 20:18547725-18547747 GCAGTGGGGAGTGGGGGTGGAGG - Intronic
1171327176 20:24305040-24305062 GCAGAGAGGAGAGGGAGGGAAGG - Intergenic
1171374248 20:24681357-24681379 CCACTGAAGAGTGGGAGAGGAGG - Intergenic
1172489836 20:35327156-35327178 GCAATGAAGAGTGAAAGGGGCGG + Intronic
1172888273 20:38246250-38246272 GCAGTGATGAGTGAGGGGGGTGG - Intronic
1173553668 20:43950475-43950497 GCAGTGGGGAGGGGGAGGGGAGG - Intronic
1174187368 20:48716288-48716310 GCAGGGGCGAGAGGGAGGTGAGG - Intronic
1174347475 20:49941024-49941046 GCAGTGAAGGCTGGGAGCGGTGG - Intronic
1174424712 20:50423747-50423769 GGAGTGAGGAGAGGGAGGGAAGG + Intergenic
1175083178 20:56437925-56437947 CCAGTGACAAATGGGAGGGTGGG + Intronic
1175601142 20:60274185-60274207 GCTGTCACAACTGGGAGGGGTGG + Intergenic
1175903051 20:62367434-62367456 GGAGAGAGGAGGGGGAGGGGCGG + Intergenic
1175931022 20:62493738-62493760 GCAGGGAGGTGTGGGGGGGGCGG + Intergenic
1176263115 20:64193660-64193682 CCAGTGAAGAGTGGGGGGTGAGG - Intronic
1178708163 21:34890595-34890617 GCAGTGCCCAGGGGGAGCGGAGG - Intronic
1179721990 21:43321381-43321403 GCAGTGAAGGGGAGGAGGGGAGG - Intergenic
1179884445 21:44307552-44307574 GCAGTGAGCAGTGAGGGGGGTGG - Intronic
1180243526 21:46529310-46529332 GCAGTGAGGACTGGGTGCGGTGG + Intronic
1183030811 22:35103068-35103090 GGAGTGAGGACTGTGAGGGGTGG - Intergenic
1183387327 22:37522429-37522451 GCAGTGGGAAGTGGGAGGCGGGG - Intergenic
1184959344 22:47917827-47917849 GCAGTAAAGAGAGGGAGGAGGGG - Intergenic
949843318 3:8343893-8343915 GCTGTGAAGAGTGGTAGGAGTGG - Intergenic
950716434 3:14850792-14850814 GCAGTGGTGGGTGGGAGGGATGG + Intronic
952233507 3:31455699-31455721 GCAGTGACAAGTGGGTGAGCCGG + Intergenic
953277453 3:41516690-41516712 GCAGTGAGGGGTGGGGGTGGGGG + Intronic
953897391 3:46812580-46812602 GGAGGGACGAGGGGGCGGGGCGG + Intergenic
954110223 3:48429400-48429422 GCAGCGCCGCGCGGGAGGGGCGG - Exonic
954349386 3:50030157-50030179 CCAGTGACTGGTGGGTGGGGCGG + Intronic
954390227 3:50264787-50264809 GCAGGGAGGAGTGGGAGGAGAGG - Intergenic
960615282 3:119590853-119590875 GCAGTGGTGAGGGGGAGGAGGGG - Intergenic
961458349 3:127035142-127035164 GCAGTGACCAGAGGGACTGGAGG + Exonic
961517350 3:127446161-127446183 GGAGTCAGGAGTGGGAGGAGAGG + Intergenic
961530128 3:127535634-127535656 GCTGTGACCAGAGCGAGGGGGGG - Intergenic
962357814 3:134709980-134710002 GCAGTGAAGGGTGGGAGGAGTGG - Intronic
967097336 3:186187765-186187787 GGAGTGACAAGTGAGCGGGGAGG + Intronic
968555717 4:1245584-1245606 GCAGGGAAGAGTGGCACGGGAGG + Intronic
968976005 4:3822342-3822364 GCACTGCCAGGTGGGAGGGGAGG - Intergenic
969505275 4:7582873-7582895 GCAGTGATGAGTGACAGGGTGGG - Intronic
971273666 4:25174897-25174919 GCTGTGACCAGCGGGATGGGTGG + Intronic
971358309 4:25914167-25914189 GGAGGGACGAGGAGGAGGGGCGG - Intronic
972091709 4:35294775-35294797 AAAGTGAAGAGCGGGAGGGGAGG - Intergenic
972810938 4:42585145-42585167 GCAATGATGAGTGGGAGGTGAGG - Intronic
975460879 4:74651315-74651337 GGAGGGAGGAGGGGGAGGGGAGG + Intergenic
975802103 4:78070979-78071001 GCAGTGACGACTGGCAAGGTTGG + Intronic
976212006 4:82680990-82681012 GCAGTGAGGACTGGTGGGGGAGG - Intronic
976841112 4:89433314-89433336 GCAGGGACAAGTGGGAGGCCTGG + Intergenic
978880923 4:113701598-113701620 TCAGTGACGAATGGCAGGGGAGG - Intronic
979942259 4:126776539-126776561 GCAGAGGCGAGGGGGTGGGGTGG + Intergenic
980970424 4:139562141-139562163 GCAGAGGTGAGTGGGATGGGTGG - Intronic
981034098 4:140152604-140152626 CCAGTCACGACTGCGAGGGGCGG - Intronic
986280337 5:6316994-6317016 GGATTGGGGAGTGGGAGGGGAGG - Intergenic
988042722 5:25909998-25910020 GCAAGGACCAGTGGGAGGAGCGG + Intergenic
989645617 5:43629151-43629173 GGGGTTAAGAGTGGGAGGGGGGG - Intronic
990813159 5:59751786-59751808 GCAGTGAAGTGTGGAAGGAGGGG - Intronic
990954926 5:61331941-61331963 GCTGTGACGCGGGGGAGGGCGGG - Intergenic
991464018 5:66891330-66891352 GCAGTGAGGAGGAGGAGGAGGGG - Intronic
992441491 5:76801296-76801318 GAAGGGAAGAGTGGGAGGAGAGG + Intergenic
995110218 5:108420746-108420768 GCAGTGAGGGGTGGGAGGGTTGG + Intergenic
995709289 5:115018455-115018477 CCAGTGCTGAGTGGGAAGGGAGG - Intergenic
995794643 5:115928765-115928787 GCTGTTACGACTTGGAGGGGGGG - Intergenic
996982332 5:129513922-129513944 GTAGTGAGGAGTTTGAGGGGAGG - Intronic
997206717 5:132054499-132054521 GCAGTGACGACTGGTAGGGAGGG + Intergenic
997520953 5:134524629-134524651 GCAGTGATGAGCGGGTGGGTGGG - Intronic
998383534 5:141742704-141742726 GCAGTGGGAAGTGGGAGGGGAGG + Intergenic
999888934 5:155956127-155956149 GCTGTGACAGGTGGGAGAGGTGG - Intronic
1001924675 5:175627475-175627497 TCAGTGCCAGGTGGGAGGGGCGG + Intergenic
1002024721 5:176389082-176389104 GAAGAGACGAGGGGGCGGGGCGG + Intronic
1002100830 5:176856770-176856792 TGCGTGAGGAGTGGGAGGGGAGG - Intronic
1002544102 5:179926949-179926971 GCAGTGTCGAGTGGGGCGAGGGG - Intronic
1002571269 5:180140590-180140612 GCAGGGAGGGGTGGGAGTGGTGG - Intronic
1002714839 5:181220341-181220363 GCGGCGACGGGTGGAAGGGGTGG + Intergenic
1003484933 6:6567304-6567326 TCAGAGACCAGTGGGTGGGGTGG + Intergenic
1003962189 6:11219176-11219198 GCAGGGAGGAGTTGGAGGTGGGG - Intronic
1004523364 6:16382888-16382910 GCAGAGGTGAATGGGAGGGGGGG + Intronic
1005069687 6:21851759-21851781 GAAGTGAGGAGAGGGAGGTGGGG - Intergenic
1005312496 6:24571757-24571779 TCGGTGAAGAATGGGAGGGGTGG - Intronic
1005348333 6:24911123-24911145 GCCGTGAGGAGGGGGAGGCGCGG + Intronic
1005800844 6:29422080-29422102 GGGGTGTAGAGTGGGAGGGGGGG + Intronic
1005905345 6:30258395-30258417 GCAGGGACTAAGGGGAGGGGAGG + Intergenic
1006132823 6:31879039-31879061 GCTGTGACGTGTGGGAGGGCGGG - Intronic
1006454143 6:34122434-34122456 GCAGTGAGGAGAGGCAGGGCCGG - Intronic
1007353754 6:41294836-41294858 GCAGTGTGGGGTGGGAGGTGGGG - Intergenic
1008067137 6:47061799-47061821 ACAGTGGCCAGAGGGAGGGGTGG - Intergenic
1008340064 6:50353518-50353540 GCAGTAATGTGTGGAAGGGGAGG - Intergenic
1008947950 6:57119651-57119673 GCATGGAGGGGTGGGAGGGGAGG - Intronic
1011366876 6:86591944-86591966 GCAGTGCCGAGTGGGAGGGGTGG + Intergenic
1011497226 6:87948974-87948996 GCAGGGAGGTGTGGAAGGGGAGG - Intergenic
1011794444 6:90937142-90937164 ACAGTGACAGGTGGGAGTGGGGG - Intergenic
1012100791 6:95083838-95083860 GCTCTGACGAGTGCGGGGGGAGG + Intergenic
1012252204 6:96991843-96991865 CCAGTGAGGAGTAGCAGGGGCGG + Intronic
1013367705 6:109447823-109447845 GCAGGGAGGAGTGGGCAGGGGGG - Intronic
1015488570 6:133799903-133799925 GCAATTCCCAGTGGGAGGGGTGG - Intergenic
1016314856 6:142773822-142773844 GCAATGTCCAGTGGGATGGGTGG + Exonic
1016917651 6:149259808-149259830 ACACTGATGAGTGGAAGGGGTGG - Intronic
1018205734 6:161435960-161435982 GCAGAGAGGAGGGGGAGGGATGG + Intronic
1018205745 6:161435987-161436009 GCAGAGAGGAGGGGGAGGGATGG + Intronic
1018205756 6:161436014-161436036 GCAGAGAGGAGGGGGAGGGATGG + Intronic
1018928769 6:168225835-168225857 TCAGGGAGGAGTGGGAGGGGTGG - Intergenic
1018953838 6:168395054-168395076 GCAGTCAGGAGTGAGAGGGAAGG - Intergenic
1019166375 6:170100264-170100286 GCAGAGTGGAGTGGGAGGGGTGG - Intergenic
1019393374 7:802428-802450 GCACTGACTGGTGGGTGGGGAGG - Intergenic
1019776138 7:2913070-2913092 GAAGTGAGGAGGGGGAGGGGAGG + Intronic
1021272512 7:18608278-18608300 GGAGAGAGGAGTGGGAGGGGAGG + Intronic
1021609402 7:22443038-22443060 GCAGGAGCGAGTGGGAGGGAAGG - Intronic
1022302636 7:29115461-29115483 GGCGGGAAGAGTGGGAGGGGAGG - Intronic
1022625268 7:32029563-32029585 GTAGTGAGGGGTGGGAGGAGAGG + Intronic
1022723738 7:32962873-32962895 GGAGTGAGGGGTGGGAGGGTGGG + Intronic
1022736492 7:33081026-33081048 GCACAGAGGGGTGGGAGGGGTGG + Intergenic
1023475388 7:40572455-40572477 GAGGTGAGGAGTTGGAGGGGAGG + Intronic
1026155030 7:67818969-67818991 GAAGGGAGGAGAGGGAGGGGAGG - Intergenic
1027190616 7:75993950-75993972 GGTGGGACGGGTGGGAGGGGTGG - Intronic
1027250046 7:76393342-76393364 GCACTGCGGCGTGGGAGGGGCGG - Intronic
1029116472 7:98240197-98240219 GCAGTGACTAGAGGATGGGGAGG + Intronic
1029139508 7:98400450-98400472 ACAGTGTCGAGGGGCAGGGGAGG + Intronic
1029529722 7:101117329-101117351 GCAGTGAGGTGTAGGAGAGGAGG - Intergenic
1032475928 7:132211475-132211497 TCAGTCCCCAGTGGGAGGGGAGG - Intronic
1034087423 7:148333038-148333060 GCTGTTAAGAGTGGCAGGGGAGG - Intronic
1034097428 7:148422935-148422957 GCAGAGACGGGTAGGAGAGGAGG + Intergenic
1034576183 7:152000509-152000531 GGAATGATGGGTGGGAGGGGAGG - Intronic
1035121363 7:156570621-156570643 GCAGGGAAGAGTGGGGGGGCGGG + Intergenic
1035341667 7:158166453-158166475 ACAGTGGCCAGTGGGAGGGGAGG - Intronic
1035341710 7:158166608-158166630 ACAGCGGCCAGTGGGAGGGGAGG - Intronic
1035965854 8:4190942-4190964 TCAGTGGAGAGTGGGGGGGGCGG + Intronic
1038476936 8:27875205-27875227 GGAGTGAAGAGAGGGAGGGAGGG - Intronic
1041743049 8:61177065-61177087 GGAGTGGCGAGGGGGCGGGGCGG + Intronic
1042307093 8:67343567-67343589 GGAGGGACGAGTGAGAGGGGCGG - Exonic
1042560974 8:70071792-70071814 GCAGTGACACGTGGGAGCGTTGG + Intergenic
1044591312 8:93916844-93916866 GCAGTGACGAGTGGGAGGGGAGG - Intronic
1047006984 8:120630720-120630742 GCAGTGAAGATGAGGAGGGGTGG - Intronic
1047276967 8:123413228-123413250 GCAGGGAGGAGTTGGGGGGGGGG - Intronic
1047998492 8:130358288-130358310 GCAGCGGCGAGAGGGAGGGAAGG + Intronic
1048464624 8:134655129-134655151 TCAGTGATGAGAGGGAGGAGAGG + Intronic
1049218671 8:141418990-141419012 GCAGAGACAAGTGGGATGTGTGG + Intronic
1049621535 8:143600411-143600433 TCACTGTGGAGTGGGAGGGGTGG + Exonic
1051431238 9:16983196-16983218 GCAGGGACGGGTGGCAGGGCGGG - Intergenic
1051459322 9:17294774-17294796 GGAGTGAGGGGAGGGAGGGGGGG + Intronic
1052354537 9:27490636-27490658 GGAGTAAGGAGTGGGAGAGGAGG + Intronic
1053932880 9:43125733-43125755 TCAGAGACGAGTGGGTGGGTGGG + Intergenic
1054465644 9:65491572-65491594 GCAGAGACCAGTGGGAGTGCTGG - Intergenic
1054802401 9:69363563-69363585 GCAGGGAAGAGTGGGGGTGGTGG + Intronic
1056097138 9:83266842-83266864 GCAGAGACGAGTGGGAAGGAGGG - Intronic
1056106611 9:83353273-83353295 GCAGTGGGGTGGGGGAGGGGGGG + Intronic
1056841835 9:90004108-90004130 GAGGTGAGGACTGGGAGGGGAGG + Intergenic
1057200646 9:93137938-93137960 GCAGGGCTCAGTGGGAGGGGAGG + Intergenic
1058679880 9:107431522-107431544 TCAGTGACAAGAGGGAGAGGAGG - Intergenic
1058939603 9:109800941-109800963 GTAGTGATGAGTGGGAGATGGGG + Intronic
1059438808 9:114291250-114291272 CCAGTGCCGCGTGGGAGGAGGGG + Intronic
1059506669 9:114805652-114805674 GAAATGTAGAGTGGGAGGGGTGG - Intronic
1061177805 9:129008150-129008172 GCTGTGAGGGGTGGGAGGGGAGG + Exonic
1062048503 9:134435392-134435414 GCAGGGACCAGTGGGGGGGCGGG - Intronic
1062093062 9:134688681-134688703 ACAGTGACAAAGGGGAGGGGCGG - Intronic
1062315071 9:135963083-135963105 CCAGTGGCCTGTGGGAGGGGAGG + Intergenic
1062359467 9:136180734-136180756 GCAGGGCCGAGTGGTAGGGCAGG + Intergenic
1062469615 9:136696838-136696860 GGAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062469625 9:136696856-136696878 GGAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062469635 9:136696874-136696896 GCAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062469657 9:136696918-136696940 GGAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062469667 9:136696936-136696958 CCAGGGAGGAGGGGGAGGGGAGG - Intergenic
1062469690 9:136696981-136697003 GGAGGGAGGAGGGGGAGGGGAGG - Intergenic
1185761100 X:2690663-2690685 GCAGGGGCGAGTGGGGAGGGGGG + Intergenic
1187463897 X:19512167-19512189 CCTGTGGGGAGTGGGAGGGGAGG + Intronic
1187574549 X:20540710-20540732 GCTGAGAAGGGTGGGAGGGGTGG - Intergenic
1189035977 X:37493668-37493690 GAGGTGAGGAGTGGGAGAGGGGG + Intronic
1189288838 X:39871004-39871026 GCTGTGAAGACTGGCAGGGGTGG + Intergenic
1189290053 X:39878388-39878410 GCAGTGGCGGGTGGGGGGGGGGG + Intergenic
1189932221 X:46025106-46025128 GCAGGGAAGAATGGGAGGGGGGG + Intergenic
1190096523 X:47485497-47485519 GCAGGGTCCATTGGGAGGGGAGG + Intergenic
1190784431 X:53630787-53630809 ACAGTGAACACTGGGAGGGGTGG + Intronic
1192420854 X:71028899-71028921 GAATTGAAGAGTGGGAGGTGAGG + Intergenic
1196046349 X:111260217-111260239 GAAGTGGCAAGTGGGAGGAGGGG + Intronic
1197347237 X:125338868-125338890 GGAGTGTCCAGTGGGAAGGGAGG - Intergenic
1197446030 X:126552859-126552881 GGGGGGCCGAGTGGGAGGGGCGG + Intergenic
1198744803 X:139878870-139878892 ACAGAGACTAGGGGGAGGGGAGG + Intronic
1198934798 X:141894976-141894998 GCAGGAAGGAGTGGGAGTGGTGG + Intronic
1199819692 X:151432523-151432545 ACAGAGACGAGTGGGAGGACTGG - Intergenic
1202075906 Y:21037861-21037883 GCAGACAGGAGTGGGGGGGGGGG - Intergenic