ID: 1044591313

View in Genome Browser
Species Human (GRCh38)
Location 8:93916847-93916869
Sequence TGCGCAGTGACGAGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 117}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591313_1044591331 28 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591313_1044591320 -7 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591320 8:93916863-93916885 CTGCGCAGCCAATCGGCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1044591313_1044591323 5 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591313_1044591333 29 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591313_1044591326 22 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591313_1044591324 18 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591313_1044591325 19 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591313_1044591327 23 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591313_1044591329 24 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591313_1044591319 -10 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591319 8:93916860-93916882 TCACTGCGCAGCCAATCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 41
1044591313_1044591321 -6 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591313 Original CRISPR TGCGCAGTGACGAGTGGGAG GGG (reversed) Intronic
900466275 1:2826995-2827017 TGCACAGTGCCAGGTGGGAGAGG + Intergenic
906586500 1:46983599-46983621 TGCCCAGTGATGAGTAGCAGAGG + Intergenic
915142934 1:153778142-153778164 TGCTCTGAGATGAGTGGGAGAGG - Exonic
915633241 1:157168139-157168161 TGTGCAGTCAAGTGTGGGAGAGG - Intergenic
919831801 1:201546387-201546409 TGCGCAGTTCCCAGGGGGAGGGG + Intergenic
924501844 1:244645498-244645520 TGCCCAGAGGCGGGTGGGAGGGG - Intergenic
924815466 1:247437847-247437869 TGCTCAGTGAAGCGTGGGATGGG + Intronic
1065205364 10:23352337-23352359 TGATCAGTGAAGAGTGGAAGGGG - Intergenic
1066394725 10:35008153-35008175 TGTGCAGTAACTAGTGCGAGTGG - Intergenic
1068854122 10:61780060-61780082 TGCACAGTGACCAATGAGAGGGG - Intergenic
1068919203 10:62465281-62465303 TGGGCACTGACAAGTGTGAGAGG + Intronic
1069016781 10:63438632-63438654 AGAGCAGTGAAAAGTGGGAGAGG - Intronic
1069203430 10:65652865-65652887 TGTGCACTGAAGAGTAGGAGAGG - Intergenic
1074158235 10:110816451-110816473 TCTGCAGTGACGAGAGGGAGGGG - Intronic
1077121141 11:909165-909187 TGAGCAGTGGGGAGCGGGAGAGG - Intronic
1077163772 11:1125962-1125984 TCTGCAGTGACGGGTGGCAGTGG + Intergenic
1077539899 11:3141578-3141600 TGCGCAGAGAGGACAGGGAGGGG + Intronic
1083887148 11:65578438-65578460 TGGGCAGAGATGAGTGGCAGGGG - Intronic
1084657911 11:70529703-70529725 TGAGCGGTTACCAGTGGGAGGGG - Intronic
1084903123 11:72325053-72325075 GGTGCAGTGAGGATTGGGAGTGG + Intronic
1085283685 11:75346538-75346560 CGGGCAGAGAGGAGTGGGAGGGG - Intronic
1091150850 11:133326852-133326874 TGTGTAGTGACGTGTGGGTGTGG + Intronic
1106856428 13:33858475-33858497 TGTGAAGTGAAGAGTGGGAAGGG - Intronic
1107225612 13:38044739-38044761 TGCCCAGTGAAGAGTAGCAGGGG - Intergenic
1112625773 13:101101760-101101782 TCAGCAGAGACGAGTGGCAGAGG + Intronic
1118457950 14:65961771-65961793 TGAGCAGGGAGGAGTGGGCGAGG + Intronic
1118882710 14:69842728-69842750 GGCCCAGTGATGAATGGGAGGGG + Intergenic
1119623590 14:76151869-76151891 GGGGCGGTGGCGAGTGGGAGGGG - Intergenic
1121405226 14:93715706-93715728 TGAGCAGTGAGGAGTGGGGCTGG + Intergenic
1126906919 15:53377949-53377971 TGGGCAGTGGGGAGGGGGAGAGG - Intergenic
1128735180 15:70049607-70049629 TGCGGACTGATCAGTGGGAGAGG - Exonic
1129383120 15:75180405-75180427 TGGGCAGTGGAGAGTGGAAGAGG + Intergenic
1132582258 16:690268-690290 GGCGCAGTGGCGCGGGGGAGCGG + Exonic
1132956770 16:2598412-2598434 TGCGTGGTGAGGAGCGGGAGGGG + Exonic
1141782467 16:86172625-86172647 TTGTCAGTGAAGAGTGGGAGGGG - Intergenic
1141992895 16:87620524-87620546 TGGGCTGTGAGGAGAGGGAGGGG + Intronic
1148863911 17:50618867-50618889 TGCCCAGTGGCGAGTGGGGCTGG - Exonic
1153289520 18:3486658-3486680 TGCCCAGTGAGGAGTGGCTGAGG + Intergenic
1157276373 18:46313758-46313780 TGCCCAGTGAGGTGGGGGAGAGG - Intergenic
1158135734 18:54205723-54205745 TGCTGAGTGACCAGTGGGATAGG - Intronic
1160873981 19:1288807-1288829 TGTGCAGTCACCGGTGGGAGTGG - Intronic
1161723019 19:5914157-5914179 TGGGCAGTGGGGAGTGGGGGAGG - Intronic
1162155634 19:8676573-8676595 TGCCCAGTGAAGATTGGGTGAGG - Intergenic
1162323247 19:9982699-9982721 TGCACAGTGAGGTGTGGGAGAGG - Intronic
1162740490 19:12771021-12771043 TGCGCTGTGCCGAGCTGGAGAGG - Exonic
1163635887 19:18437124-18437146 GGCGAGGTGACGGGTGGGAGTGG + Intronic
1166538677 19:43592013-43592035 TGCCCAGTGAGGAGTGGGAGGGG - Exonic
925286334 2:2717950-2717972 TGTCCAGTGACCAGAGGGAGAGG - Intergenic
925747265 2:7054120-7054142 TGCGCAGTTGCTTGTGGGAGTGG + Intronic
930599240 2:53424586-53424608 TGCCCAGTGAGGAGTAGTAGCGG + Intergenic
930839001 2:55825439-55825461 TGCGCAGTGAGGAGTAGCAGGGG - Intergenic
932212812 2:69946084-69946106 TGCACAGGGACCAGTGGGCGTGG + Intergenic
938177203 2:129144553-129144575 TGCGCAGTTCCGGGTGGGCGCGG - Intergenic
943182404 2:184560762-184560784 TGGGCAGGGACGAGAGTGAGAGG - Intergenic
944471193 2:200055316-200055338 TGCCCAGTGAGGAGTGGTGGGGG - Intergenic
946297893 2:218800205-218800227 AGGCCAGTGAAGAGTGGGAGGGG + Intronic
946375635 2:219307525-219307547 TGGGCAGTGCCAGGTGGGAGTGG - Exonic
948190795 2:236056936-236056958 TGACCAGGGGCGAGTGGGAGTGG - Intronic
948291967 2:236832309-236832331 TGGGCTGTGAAGGGTGGGAGTGG + Intergenic
948360173 2:237414250-237414272 TCTGCAGTGAGGAGGGGGAGAGG - Exonic
1169966434 20:11222967-11222989 TTGGAAGTGAGGAGTGGGAGAGG + Intergenic
1170571598 20:17635876-17635898 TGAGCAGTGAGGAGGGAGAGAGG - Intronic
1171241150 20:23568145-23568167 TGCTCAGTGAAAAATGGGAGTGG - Intronic
1172993395 20:39052241-39052263 TGTGCAGTGAGGGGTGGGGGTGG + Intergenic
1174557251 20:51404766-51404788 GGCGCAGTGAGGCCTGGGAGGGG - Intronic
1178919984 21:36732403-36732425 TTGCCAGTGTCGAGTGGGAGGGG + Intronic
1181338214 22:22157274-22157296 TGGGCAGTGAGGAGGGAGAGAGG - Intergenic
1185064329 22:48623216-48623238 TGCGCGGTGACCTGTGGGACGGG + Intronic
1185064339 22:48623255-48623277 TGCGCGGTGACCTGTGGGACGGG + Intronic
1185064348 22:48623294-48623316 TGCGCGGTGACCTGTGGGACGGG + Intronic
1185064366 22:48623372-48623394 TGCGCGGTGACCTGTGGGACGGG + Intronic
1185064375 22:48623411-48623433 TGCGCGGTGACCTGTGGGACGGG + Intronic
1185064384 22:48623450-48623472 TGCGCGGTGACCTGTGGGACGGG + Intronic
953886702 3:46718079-46718101 AGCGGAGTGAGGAGAGGGAGGGG - Exonic
954355123 3:50078423-50078445 TGGGGAGTGAGGAGTGGGAGAGG + Intronic
957593115 3:82225702-82225724 TGCCCAGTGAGGAGTAGCAGGGG + Intergenic
958594233 3:96201335-96201357 TGCCCAGTGAGGAGTAAGAGGGG - Intergenic
960131060 3:114056599-114056621 TGCGCAGAGCCTCGTGGGAGTGG - Exonic
961424174 3:126831883-126831905 TGCTGAGTGAGGAGTGCGAGGGG + Intronic
964304526 3:155326206-155326228 GGTGCAGGGGCGAGTGGGAGTGG - Intergenic
965899398 3:173619933-173619955 TGTGCAGGGATGAGTGGGAGAGG + Intronic
967071719 3:185968260-185968282 TGGGAAGAGAAGAGTGGGAGAGG - Intergenic
967186205 3:186946808-186946830 TGGGGAGTGAAGAGTGGGAACGG + Intronic
969620455 4:8276296-8276318 TGCCCAGTGACCAGTGAGGGGGG - Intronic
970508716 4:16758888-16758910 CACCCAGTGATGAGTGGGAGCGG - Intronic
977555226 4:98481390-98481412 TGCTCAGAGACGGGAGGGAGTGG + Intronic
977638203 4:99324900-99324922 TGCAAAATGAAGAGTGGGAGAGG + Intergenic
979382875 4:120029328-120029350 TGGGCAGTGGCAACTGGGAGTGG - Intergenic
984761478 4:183366499-183366521 TGCGCGATGAGGAGAGGGAGAGG + Intergenic
985889710 5:2705939-2705961 TGAGCTGTGACGGGAGGGAGGGG + Intergenic
986034789 5:3927330-3927352 TGTGTATTGACGGGTGGGAGAGG - Intergenic
990237519 5:53783931-53783953 GGTGCAGTCAGGAGTGGGAGAGG - Intergenic
993735848 5:91476390-91476412 TGGGCAGTGGCGAGTTGGGGAGG + Intergenic
997948261 5:138221397-138221419 GGCCCAGTGAGGAGAGGGAGTGG - Intergenic
998074247 5:139223347-139223369 TGAGCACTGACGTGTGGGAGAGG + Intronic
998143619 5:139713223-139713245 TGGGCAGGGAAGAGTGAGAGTGG + Intergenic
998537349 5:142946397-142946419 TGGGCAGTGATTTGTGGGAGTGG + Intronic
1000164948 5:158639298-158639320 TGGGCAGTGAGGGGTGGGGGTGG + Intergenic
1003683425 6:8277950-8277972 TGCGCAGGGATGTGGGGGAGGGG + Intergenic
1006891604 6:37433557-37433579 TGCGCAGAGACGTGTGTCAGCGG - Intronic
1007249504 6:40486194-40486216 TGGGCAGTGGGCAGTGGGAGTGG + Intronic
1011366863 6:86591897-86591919 TGGACAGTGCCAAGTGGGAGGGG + Intergenic
1011366875 6:86591941-86591963 TTAGCAGTGCCGAGTGGGAGGGG + Intergenic
1012252201 6:96991840-96991862 TGCCCAGTGAGGAGTAGCAGGGG + Intronic
1017809359 6:157973813-157973835 CGCGCTCTGACAAGTGGGAGAGG - Intergenic
1018928770 6:168225838-168225860 TGCTCAGGGAGGAGTGGGAGGGG - Intergenic
1021483564 7:21144360-21144382 TCCACAGTGACGAGTAGGGGAGG - Intergenic
1023240658 7:38143258-38143280 TTTGCAGGGACTAGTGGGAGGGG + Intergenic
1023811384 7:43914984-43915006 TGCGCACTGAAGAATGGGGGTGG + Intronic
1035377177 7:158413156-158413178 TGCTCAGTGGCGAGAGGGAAGGG - Intronic
1044591313 8:93916847-93916869 TGCGCAGTGACGAGTGGGAGGGG - Intronic
1046547381 8:115668769-115668791 TGCCCGGTGCCGGGTGGGAGAGG + Exonic
1049427601 8:142544335-142544357 TTCGCAGCGTGGAGTGGGAGAGG + Exonic
1049810835 8:144569630-144569652 TGTGCAGAGACAGGTGGGAGGGG + Intronic
1051678514 9:19582897-19582919 TGCGGAGTGGGGAGTGGGAAAGG - Intronic
1052893415 9:33724573-33724595 TCAGGAGTTACGAGTGGGAGAGG - Intergenic
1053607848 9:39679170-39679192 TGCACAGTGAGGAGTAGCAGGGG - Intergenic
1054245686 9:62663239-62663261 TGCACAGTGAGGAGTAGCAGGGG + Intergenic
1054559812 9:66697770-66697792 TGCACAGTGAGGAGTAGCAGGGG + Intergenic
1057987417 9:99731502-99731524 TGTGCAGTGACTGGGGGGAGAGG + Intergenic
1058508855 9:105694584-105694606 CGCGCGGTGAGGAGTAGGAGAGG - Exonic
1060245602 9:121943453-121943475 TGGGCATTAACAAGTGGGAGAGG - Intronic
1061177804 9:129008147-129008169 TGAGCTGTGAGGGGTGGGAGGGG + Exonic
1061533771 9:131235041-131235063 TGTGCAGTTAGGAGAGGGAGGGG + Intergenic
1187415584 X:19090433-19090455 TGCGCAGCCACGTGAGGGAGGGG - Intronic
1192430888 X:71110871-71110893 TGAGAAGGGACGAGGGGGAGGGG - Intronic
1198934797 X:141894973-141894995 TGGGCAGGAAGGAGTGGGAGTGG + Intronic