ID: 1044591314

View in Genome Browser
Species Human (GRCh38)
Location 8:93916848-93916870
Sequence CTGCGCAGTGACGAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591314_1044591323 4 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591314_1044591321 -7 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591314_1044591327 22 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591314_1044591333 28 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591314_1044591324 17 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591314_1044591326 21 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591314_1044591325 18 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591314_1044591331 27 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591314_1044591329 23 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591314_1044591320 -8 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591320 8:93916863-93916885 CTGCGCAGCCAATCGGCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591314 Original CRISPR CTGCGCAGTGACGAGTGGGA GGG (reversed) Intronic
900425831 1:2578174-2578196 CTGGGCAGTGAGCACTGGGATGG + Intergenic
901164550 1:7208692-7208714 CTGAGCCTTGAAGAGTGGGAAGG + Intronic
901689555 1:10963909-10963931 CTGAGCAAGGACGAGTGAGATGG - Intronic
904277568 1:29394421-29394443 CTGCTCTGTGACCTGTGGGATGG + Intergenic
907020328 1:51060497-51060519 CTGCAGTGTGACGAGTGGGGTGG - Intergenic
907111861 1:51934024-51934046 CTGCCCAGTGAGGAGAGGGATGG - Intronic
909695678 1:78465675-78465697 CTGCCCAGTGAAGAGTAGCAGGG + Intronic
910065258 1:83143821-83143843 CTGCCCAGTGAGGAGTAGCAGGG + Intergenic
912641632 1:111351780-111351802 TTGCTCAGTGTGGAGTGGGAAGG + Exonic
924741785 1:246798459-246798481 CTGTGCAGTGAGGAATGAGAAGG + Intergenic
924815465 1:247437846-247437868 GTGCTCAGTGAAGCGTGGGATGG + Intronic
1064039653 10:11949126-11949148 CTGGGCAGTGAAATGTGGGATGG - Intronic
1064701251 10:18023875-18023897 CTGCTCAGTGAGGAGTAGCAGGG + Intronic
1065205365 10:23352338-23352360 CTGATCAGTGAAGAGTGGAAGGG - Intergenic
1065638533 10:27755401-27755423 CTGTGAAGTGAGGAGTCGGAAGG - Intergenic
1068854123 10:61780061-61780083 CTGCACAGTGACCAATGAGAGGG - Intergenic
1070541247 10:77416986-77417008 CAGGTCAGTGACGAGTGGGGAGG - Intronic
1071523427 10:86344925-86344947 CTGACCAGTGAGGAGTGGGCTGG + Intronic
1074158236 10:110816452-110816474 GTCTGCAGTGACGAGAGGGAGGG - Intronic
1074236612 10:111591033-111591055 CTGCTCAAACACGAGTGGGAAGG + Intergenic
1074813127 10:117125250-117125272 CTGTTCAGAGACCAGTGGGAGGG - Intronic
1080112327 11:28582044-28582066 ATGCGGAGTGAAGAGGGGGAGGG - Intergenic
1082085399 11:48045632-48045654 CTGGGCAGTGATGGGTGGAAGGG + Intronic
1083687959 11:64388634-64388656 CTGCGAAGTGACGGCTGGGCTGG + Intergenic
1083887149 11:65578439-65578461 CTGGGCAGAGATGAGTGGCAGGG - Intronic
1085044505 11:73345275-73345297 CTGGGCTCTGACGGGTGGGAAGG - Intronic
1086284073 11:85225331-85225353 CTGCGGAGAGATGAGTGGGCTGG - Intronic
1093151998 12:15632906-15632928 CTACTCACTGACCAGTGGGATGG + Intronic
1094831602 12:34302794-34302816 CTGCGCAGTGTCTGCTGGGAAGG - Intergenic
1094836516 12:34324640-34324662 CTGCGCAGTGGCTGCTGGGAAGG + Intergenic
1100027793 12:90151087-90151109 CTGGGGAGTGACTAGTGGAAAGG - Intergenic
1102821820 12:115915052-115915074 CTGGGCCTTGAAGAGTGGGAGGG + Intergenic
1105050804 12:133048957-133048979 CTGGTCAGTGACGGGTGGGCTGG + Intronic
1105881033 13:24606866-24606888 CTGCGCAGTGAGGAGCAGCAGGG + Intergenic
1106856429 13:33858476-33858498 TTGTGAAGTGAAGAGTGGGAAGG - Intronic
1107225613 13:38044740-38044762 CTGCCCAGTGAAGAGTAGCAGGG - Intergenic
1112567826 13:100566399-100566421 CTGAGGAGTGAAGAGTGTGAAGG - Intronic
1118738806 14:68723147-68723169 CTGGGCTGTGGGGAGTGGGACGG - Intronic
1121229073 14:92343031-92343053 CTGCGCAGGGATGTGTGTGATGG - Intronic
1130015143 15:80180463-80180485 CAGCGCAGTGACACGTGGGGAGG + Intronic
1132710256 16:1263192-1263214 CTGCGCAGGGAGGAGAGGGCTGG + Intergenic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1137068250 16:35873625-35873647 CTACGAAGTGACTAGTGGGTGGG + Intergenic
1139938924 16:70590917-70590939 CAGCGCACTGACGACGGGGAGGG - Intronic
1141610560 16:85178806-85178828 CTGCACAGTGACGAGTGTCCTGG + Intronic
1141937284 16:87249350-87249372 CTGTGGAGTTACCAGTGGGATGG - Intronic
1143110078 17:4548163-4548185 CTGCGCAGTGAAGGGTGTCACGG + Exonic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1152659052 17:81534110-81534132 CTGATCAGTGATGAGTGTGAGGG + Intronic
1153618126 18:6952698-6952720 CTGGGCAGGACCGAGTGGGATGG - Intronic
1153729823 18:7999514-7999536 CTGAGCAGAGGCAAGTGGGATGG + Intronic
1162754284 19:12847837-12847859 CTGCGCAGTGGCCTGCGGGAGGG - Exonic
1164537073 19:29093654-29093676 CTGGGCAGTTAGGTGTGGGAAGG + Intergenic
1164582753 19:29444874-29444896 CTGCTGAGTGCAGAGTGGGAAGG + Intergenic
1165098879 19:33426663-33426685 CTGCGCAGTGACCACTGGCTTGG - Intronic
1165900387 19:39166924-39166946 CTGTGCAGTGCCCAGAGGGAAGG + Intronic
1166538678 19:43592014-43592036 CTGCCCAGTGAGGAGTGGGAGGG - Exonic
1168708122 19:58481089-58481111 CTCTGCACAGACGAGTGGGAAGG - Exonic
925128089 2:1476090-1476112 CTGGGCACTGAGGAGTAGGAAGG - Intronic
930839002 2:55825440-55825462 CTGCGCAGTGAGGAGTAGCAGGG - Intergenic
933670616 2:85004017-85004039 CTGCTAAGTGACTAGTGGGCAGG + Intronic
936715766 2:115186145-115186167 CTCCGCAGTGATGAGAGTGAGGG - Intronic
940145310 2:150539862-150539884 CTGAGCAGTGACTAATGTGAAGG + Intergenic
940765803 2:157788440-157788462 CTGCTCAGTGACTAGCAGGATGG - Intronic
944471194 2:200055317-200055339 CTGCCCAGTGAGGAGTGGTGGGG - Intergenic
1168861292 20:1047827-1047849 CTGTGCAGAGATGAGTTGGAAGG + Intergenic
1176549780 21:8216142-8216164 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1176557671 21:8260371-8260393 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1176568705 21:8399176-8399198 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1176576619 21:8443411-8443433 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1179981648 21:44899081-44899103 CTTCGCGGTGACCAGTAGGATGG - Exonic
1182327642 22:29525799-29525821 CTGGGCAATGACGTGCGGGATGG - Intronic
1184927978 22:47657458-47657480 CTGCGCGGAGAGGAGTGGCAGGG + Intergenic
1185064328 22:48623215-48623237 CTGCGCGGTGACCTGTGGGACGG + Intronic
1185064338 22:48623254-48623276 CTGCGCGGTGACCTGTGGGACGG + Intronic
1185064347 22:48623293-48623315 CTGCGCGGTGACCTGTGGGACGG + Intronic
1185064356 22:48623332-48623354 CTGCGTGGTGACCTGTGGGACGG + Intronic
1185064365 22:48623371-48623393 CTGCGCGGTGACCTGTGGGACGG + Intronic
1185064374 22:48623410-48623432 CTGCGCGGTGACCTGTGGGACGG + Intronic
1185064383 22:48623449-48623471 CTGCGCGGTGACCTGTGGGACGG + Intronic
1203254669 22_KI270733v1_random:132468-132490 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1203262725 22_KI270733v1_random:177547-177569 CTACGCCGCGACGAGTAGGAGGG + Intergenic
949861105 3:8505603-8505625 CTGTGCAGTCACCAGTGGGCTGG + Intronic
952822686 3:37498681-37498703 GTGGGCAGTGGTGAGTGGGAAGG + Intronic
953886703 3:46718080-46718102 CAGCGGAGTGAGGAGAGGGAGGG - Exonic
954191702 3:48967136-48967158 CTGCACAGTGGTGAGGGGGATGG - Exonic
954213308 3:49110437-49110459 CAGCGCAGTGACGTGGGTGAGGG - Exonic
957593114 3:82225701-82225723 CTGCCCAGTGAGGAGTAGCAGGG + Intergenic
958594234 3:96201336-96201358 CTGCCCAGTGAGGAGTAAGAGGG - Intergenic
960570663 3:119182249-119182271 CTGTGCAGTGAACAGAGGGAAGG + Intronic
962385290 3:134927880-134927902 GTTTACAGTGACGAGTGGGAGGG + Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
968613473 4:1567353-1567375 CTGCGCAGCGAGGAGTGGGTGGG - Intergenic
970179473 4:13375053-13375075 CTGGGCAGTTTGGAGTGGGAAGG - Intronic
977934683 4:102787694-102787716 CTGAGCAGGAAGGAGTGGGATGG + Intergenic
983628397 4:169826103-169826125 CTGCCCAGTGAGGAGTAGTAGGG + Intergenic
991898747 5:71435030-71435052 GTGGGAAGTGACAAGTGGGAAGG + Intergenic
992795702 5:80253639-80253661 CTGCTCAGTGAGGAGAGGCAAGG - Intronic
995110217 5:108420742-108420764 GTGAGCAGTGAGGGGTGGGAGGG + Intergenic
1000460721 5:161514236-161514258 CTGGGCTGTGAAGAATGGGAGGG - Intronic
1001313239 5:170625907-170625929 CTGAGCAGTGACCTGGGGGATGG + Intronic
1003053846 6:2802173-2802195 CTGAGCAGTAACGTGGGGGAAGG - Intergenic
1003683424 6:8277949-8277971 CTGCGCAGGGATGTGGGGGAGGG + Intergenic
1008756748 6:54804763-54804785 CTGCGCAGTGAAGAATAGAATGG - Intergenic
1011366874 6:86591940-86591962 GTTAGCAGTGCCGAGTGGGAGGG + Intergenic
1011556317 6:88574136-88574158 CTGCGGAGTGACCACGGGGAGGG - Intergenic
1012252200 6:96991839-96991861 CTGCCCAGTGAGGAGTAGCAGGG + Intronic
1012884010 6:104824006-104824028 CTGCACAGTGATGAGTAGTAAGG + Intronic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1017685916 6:156913869-156913891 CTGGGAAGTGAAGAGTGGGATGG - Intronic
1018928771 6:168225839-168225861 CTGCTCAGGGAGGAGTGGGAGGG - Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1027278849 7:76590926-76590948 CTGCCCAGTGAGGAGTAGCAGGG - Intergenic
1029084093 7:97997864-97997886 CTGTGTAGTGACGTGGGGGATGG + Intergenic
1031887117 7:127253957-127253979 CTGGGCAGTAACTAGTGGGGAGG - Intergenic
1035377178 7:158413157-158413179 CTGCTCAGTGGCGAGAGGGAAGG - Intronic
1036086066 8:5614477-5614499 CTGTGCAGTAGCGAGTGGTAAGG + Intergenic
1037177971 8:15969214-15969236 CTGCTCAATGACGAGTATGAAGG - Intergenic
1038700661 8:29846678-29846700 CTGGCCAGTGGCAAGTGGGAAGG - Intergenic
1044591314 8:93916848-93916870 CTGCGCAGTGACGAGTGGGAGGG - Intronic
1051583928 9:18706856-18706878 CTGCCTATTGACGAGTGTGAAGG + Exonic
1052292089 9:26853631-26853653 CTGAGCAATGACGAGTGAAATGG + Intronic
1053607849 9:39679171-39679193 CTGCACAGTGAGGAGTAGCAGGG - Intergenic
1054245685 9:62663238-62663260 CTGCACAGTGAGGAGTAGCAGGG + Intergenic
1054559811 9:66697769-66697791 CTGCACAGTGAGGAGTAGCAGGG + Intergenic
1059669761 9:116480899-116480921 CTAAGCAGTGACACGTGGGATGG - Intronic
1060504991 9:124191069-124191091 CTCCGCAGCCAGGAGTGGGATGG - Intergenic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1062025426 9:134338116-134338138 CTGGGCAGTGACCACAGGGAGGG + Intronic
1203698117 Un_GL000214v1:115472-115494 CAGCGCAGTGACTGATGGGAAGG - Intergenic
1203471070 Un_GL000220v1:115613-115635 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1203478891 Un_GL000220v1:159585-159607 CTACGCCGCGACGAGTAGGAGGG + Intergenic
1187415585 X:19090434-19090456 CTGCGCAGCCACGTGAGGGAGGG - Intronic
1192941774 X:75920376-75920398 CTGCACAGTGAGGAGTAGGAAGG - Intergenic
1193067450 X:77275058-77275080 CTGCCCAGTGAGGAGTAGAAGGG - Intergenic
1200411518 Y:2866575-2866597 CTCAGCAGTGAGGAGTGGGAGGG + Intronic
1201152557 Y:11101980-11102002 CAGCGCAGGGACGGATGGGAAGG + Intergenic