ID: 1044591315

View in Genome Browser
Species Human (GRCh38)
Location 8:93916849-93916871
Sequence GCTGCGCAGTGACGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591315_1044591326 20 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591315_1044591334 30 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591315_1044591320 -9 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591320 8:93916863-93916885 CTGCGCAGCCAATCGGCAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1044591315_1044591324 16 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591315_1044591321 -8 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591315_1044591325 17 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591315_1044591331 26 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591315_1044591333 27 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591315_1044591329 22 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591315_1044591327 21 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591315_1044591323 3 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591315 Original CRISPR GCTGCGCAGTGACGAGTGGG AGG (reversed) Intronic
905456463 1:38091558-38091580 GCTGCACAGTGAGGAGAGGAGGG + Intergenic
905722847 1:40221542-40221564 GCTACGCAGTTACAAGGGGGTGG - Intronic
907316613 1:53576556-53576578 GCTGGGCAGTGAGGAGGTGGGGG - Intronic
907634606 1:56121102-56121124 GCTTCACAGTCAGGAGTGGGAGG - Intergenic
917505148 1:175620630-175620652 GCAGAGCAGTGGCGAGTAGGTGG + Intronic
917790273 1:178494911-178494933 GCGGCGAAGTGCAGAGTGGGCGG - Intergenic
918446495 1:184622338-184622360 GCTGCCTAGTGGCCAGTGGGTGG + Exonic
919793764 1:201308866-201308888 GCTGGGCAGGGGCCAGTGGGGGG + Intronic
920373390 1:205493370-205493392 GCTTCTGAGTGAGGAGTGGGAGG + Intergenic
920432989 1:205930555-205930577 GCTACACAATGATGAGTGGGAGG - Intronic
1068569668 10:58615638-58615660 GCTGAGGACTGAGGAGTGGGTGG - Intronic
1070535440 10:77373951-77373973 CATGCACAGTGACCAGTGGGTGG + Intronic
1071023326 10:81083523-81083545 CCTGCCCAGTGAGGAGTGGCAGG + Intergenic
1073206409 10:101771623-101771645 GCTGGGCTGTGACAAGTGTGTGG - Intronic
1073845260 10:107546403-107546425 GCTGCTAAGTGACTAATGGGTGG + Intergenic
1073971393 10:109048088-109048110 GCTGCGCTGTGCTGAGTGCGGGG - Intergenic
1074158237 10:110816453-110816475 GGTCTGCAGTGACGAGAGGGAGG - Intronic
1075610439 10:123850542-123850564 GCTGCTAAGTGACTACTGGGCGG - Intronic
1075676443 10:124299146-124299168 TCTGCCCAGTGACCAGTGGAGGG + Intergenic
1077101070 11:822637-822659 GGTGCCCAGTGAGGAGTGGCTGG - Intronic
1077336415 11:2006905-2006927 GCTGCAACGTGACCAGTGGGTGG + Intergenic
1077404780 11:2378001-2378023 GCTTCGCGGGGACGAGGGGGGGG + Intronic
1079106365 11:17574829-17574851 CCTGAGCAGAGACGAGTGTGTGG + Exonic
1085022537 11:73218415-73218437 GCAGCGCAGTGGCGAGAGGTGGG + Exonic
1085515298 11:77108129-77108151 GCTGCCCTGTGACCAGTGTGGGG + Intronic
1086226734 11:84520594-84520616 GCTGGGCAGTGAGGGTTGGGTGG - Intronic
1089226225 11:116924790-116924812 GCTGGTCAGTGCAGAGTGGGTGG + Intronic
1090240967 11:125181584-125181606 GCTGCCCAGTGAGGGCTGGGAGG + Intronic
1091171782 11:133526153-133526175 GGGGCGCAGAGGCGAGTGGGTGG + Intronic
1202819399 11_KI270721v1_random:62087-62109 GCTGCAACGTGACCAGTGGGTGG + Intergenic
1091712773 12:2753359-2753381 GCTGGGCAGAGAGGAGAGGGAGG + Intergenic
1093977683 12:25440762-25440784 GCTGCTAAGTGACTAATGGGTGG + Intronic
1096556086 12:52404865-52404887 GCTGCCCAGTGAGGAAGGGGAGG - Intronic
1101610860 12:106290355-106290377 TCTGCGCAGAGTCCAGTGGGAGG + Intronic
1102471047 12:113160114-113160136 GCTGAGAAGTGAGGTGTGGGTGG + Intronic
1103649358 12:122421669-122421691 GCTGTGCAGGGAGGAGGGGGTGG + Intronic
1103755642 12:123204503-123204525 GCTGAGAAGTGATGGGTGGGGGG - Intronic
1103925977 12:124423519-124423541 GCGGCGCAGTGAGGAATGGCAGG + Intronic
1106273208 13:28174750-28174772 GATGAGTAGTGACGAGAGGGAGG - Intronic
1107225614 13:38044741-38044763 GCTGCCCAGTGAAGAGTAGCAGG - Intergenic
1111281407 13:86029748-86029770 GCAGTGCAGTGACGAATTGGTGG + Intergenic
1112486470 13:99824947-99824969 TCTGCCCAATGAAGAGTGGGGGG - Intronic
1113560352 13:111273805-111273827 GCTGCCCAGTGAGGAGTTGGGGG + Exonic
1113940566 13:114016516-114016538 GCTGCGGAGGGACAAGTGAGAGG + Intronic
1114532882 14:23406365-23406387 CCTGCACAGTGACTAGCGGGTGG + Intronic
1114631977 14:24164903-24164925 GCTGCCCAGCAACGAGTGCGTGG + Exonic
1117888311 14:60389035-60389057 GCTGCTAAGTGACTAATGGGTGG - Intergenic
1126432066 15:48597096-48597118 GCTGGGCTTTGAAGAGTGGGTGG - Intronic
1129742811 15:77998168-77998190 GCTGGTCAGTGACGAGGAGGAGG - Exonic
1129747993 15:78038321-78038343 GCACGGCAGTGAGGAGTGGGAGG + Intronic
1129842659 15:78753278-78753300 GCTGGTCAGTGACGAGGAGGAGG + Intergenic
1134237737 16:12480765-12480787 GCTGAGCTCTGAGGAGTGGGAGG + Intronic
1134422910 16:14111383-14111405 TCTGCTCAGTGATGAGGGGGTGG + Intronic
1137068249 16:35873624-35873646 GCTACGAAGTGACTAGTGGGTGG + Intergenic
1139938925 16:70590918-70590940 GCAGCGCACTGACGACGGGGAGG - Intronic
1139946701 16:70646968-70646990 GCTGCGCTGTGAGTACTGGGGGG + Exonic
1140517805 16:75556833-75556855 TCTGTGCACTGACGAGTGGCCGG + Intergenic
1144369444 17:14576022-14576044 GCTGAGCAGAGACTAGGGGGTGG - Intergenic
1146515599 17:33486788-33486810 GCTGGCCAGTGAGAAGTGGGAGG - Intronic
1147014399 17:37479281-37479303 GCTGGGTAGTTAGGAGTGGGAGG + Exonic
1147416047 17:40290671-40290693 GCTACTAAGTGACTAGTGGGTGG + Intronic
1152098871 17:78289343-78289365 GCTGAGGGGTGACGAGTAGGAGG - Intergenic
1157822637 18:50784938-50784960 GCTGCTCAGTGACCAGAGGAGGG - Intergenic
1157852624 18:51070760-51070782 GCTACTCAGTGACTAATGGGTGG - Intronic
1158757141 18:60339207-60339229 GCTCTGCAGTGGCTAGTGGGTGG + Intergenic
1159359404 18:67381395-67381417 TCTGCCCAGTGAAGGGTGGGGGG + Intergenic
1162583998 19:11547911-11547933 TCTGCGCAGTGAGGACAGGGCGG - Intronic
1163453960 19:17395104-17395126 GCTGCCCAGTGGCGAGCAGGCGG - Intergenic
1163455470 19:17403661-17403683 GCTGGTCAGTGAGGAGGGGGCGG - Exonic
1163738382 19:18995642-18995664 GCAGCCCAGGGAAGAGTGGGGGG + Intronic
1166538679 19:43592015-43592037 CCTGCCCAGTGAGGAGTGGGAGG - Exonic
1167521899 19:49960240-49960262 GCTGAGCACTGAGAAGTGGGAGG + Exonic
1167523485 19:49970482-49970504 GCTGAGCACTGAGAAGTGGGAGG - Intergenic
1167756580 19:51416769-51416791 GCTGAGCACTGAGAAGTGGGAGG + Exonic
1168714112 19:58517229-58517251 GCTGCGCAGGTGCGAGTGGCGGG + Exonic
927591299 2:24360321-24360343 GTCGCGCTGTGACGAGCGGGAGG - Exonic
929055705 2:37874522-37874544 GCTGGGCAGTGACAAGCTGGGGG + Intergenic
929438759 2:41949037-41949059 GCTGAGCAGGAACCAGTGGGTGG - Intronic
930599127 2:53423730-53423752 GCTGCTTGGTGAAGAGTGGGAGG + Intergenic
930839003 2:55825441-55825463 CCTGCGCAGTGAGGAGTAGCAGG - Intergenic
931907074 2:66854122-66854144 GCTGTGCAGTGAGAAGTGGGTGG - Intergenic
936715767 2:115186146-115186168 GCTCCGCAGTGATGAGAGTGAGG - Intronic
944471195 2:200055318-200055340 ACTGCCCAGTGAGGAGTGGTGGG - Intergenic
949010796 2:241677280-241677302 GCTGCACAGTGGCCAGTGAGAGG - Intronic
1170593107 20:17786250-17786272 GCTGCTCTGTCACGAGAGGGTGG - Intergenic
1173555320 20:43961605-43961627 GCTGCACTGTGGCGGGTGGGTGG + Intronic
1173683978 20:44910008-44910030 GGTGCGCAGGGACGCGGGGGCGG + Intergenic
1176146512 20:63567935-63567957 CCTGCCCAGTGGGGAGTGGGAGG - Intronic
1176213699 20:63938620-63938642 GCTGCTCAGGGTCGGGTGGGGGG + Intergenic
1176549779 21:8216141-8216163 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1176557670 21:8260370-8260392 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1176568704 21:8399175-8399197 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1176576618 21:8443410-8443432 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1178111666 21:29375563-29375585 TCTGAGCAGTGAGGACTGGGTGG + Intronic
1179133626 21:38660772-38660794 GCGGGGCAGGGACGCGTGGGCGG + Intronic
1179445743 21:41429003-41429025 GCTGTGCAGTAGCGAGTGGATGG + Intronic
1179554227 21:42162373-42162395 GCTGGGCAGTGGTGAGTAGGGGG + Intergenic
1179554345 21:42162890-42162912 GCTGTGCAGGGGTGAGTGGGAGG + Intergenic
1183955320 22:41376747-41376769 GGTGTGCAGTGTGGAGTGGGTGG - Intronic
1203254668 22_KI270733v1_random:132467-132489 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1203262724 22_KI270733v1_random:177546-177568 GCTACGCCGCGACGAGTAGGAGG + Intergenic
949329980 3:2910990-2911012 GCTACGCTGTGGGGAGTGGGAGG - Intronic
953178481 3:40574185-40574207 GCAGAGGAGTGAGGAGTGGGAGG + Intronic
961651189 3:128417430-128417452 GCTGCTCAATGAAGAATGGGTGG - Intergenic
961688365 3:128650850-128650872 GCTGCTCAGTGGCGGGAGGGCGG - Intronic
968613474 4:1567354-1567376 CCTGCGCAGCGAGGAGTGGGTGG - Intergenic
970579743 4:17464412-17464434 GCTACTGAGTGACTAGTGGGTGG - Intronic
972436719 4:39042501-39042523 GCTGAGAAGTGAGGAGTTGGGGG + Intergenic
976692661 4:87885381-87885403 GCTGTGCAGTCACGTGTGGCAGG - Intergenic
978820042 4:112956533-112956555 GCTTCTAAGTGACTAGTGGGCGG + Intronic
981907055 4:149933356-149933378 GCTGCTGAGTGCCTAGTGGGTGG - Intergenic
984265369 4:177492191-177492213 GCTGCTAAGTGACTAATGGGTGG + Intergenic
990253700 5:53943100-53943122 GCTGGTCAGTGGGGAGTGGGCGG + Intronic
998852089 5:146360783-146360805 GCTGCCCAGTGCCCAGTGTGTGG - Intergenic
1000460722 5:161514237-161514259 GCTGGGCTGTGAAGAATGGGAGG - Intronic
1004145313 6:13060531-13060553 GCTGAGAAGTGAGGAGTAGGTGG + Intronic
1006470066 6:34223758-34223780 GCTGAGCAGTGAGGGGAGGGAGG - Intergenic
1011763987 6:90599309-90599331 GCTGCTAAGTGACTAATGGGTGG - Intergenic
1011812369 6:91147438-91147460 GATGATCAGTGAGGAGTGGGAGG + Intergenic
1013368930 6:109454221-109454243 GCTGGGCAGAGATGAGTGGCTGG + Exonic
1015187856 6:130438940-130438962 GCAGGGCAGTGGGGAGTGGGTGG + Exonic
1018928772 6:168225840-168225862 GCTGCTCAGGGAGGAGTGGGAGG - Intergenic
1019204026 6:170344129-170344151 GCTGCTCAGGAACGAGTGAGAGG - Intronic
1019814197 7:3187647-3187669 GCTGGGCAGTGTGGAGTGCGAGG - Intergenic
1022388475 7:29923594-29923616 GCTTCACAGTGCCGAGTTGGCGG - Intronic
1023857010 7:44190106-44190128 GCTGCGAAGGGGAGAGTGGGTGG - Intronic
1024639887 7:51319776-51319798 TCTGCTCAGTGACAAGTGGTAGG - Intergenic
1027978157 7:85185321-85185343 GGCGCGCAGAGACGAGGGGGAGG - Intronic
1030499711 7:110344088-110344110 GCTGAGCAGAGACAAGTGGAGGG + Intergenic
1034912583 7:155009487-155009509 GCTGGGCAGTGAGGGGAGGGAGG + Intergenic
1035965851 8:4190937-4190959 GCGGCTCAGTGGAGAGTGGGGGG + Intronic
1038664947 8:29529848-29529870 GCTGTGCTGGGACGAGTGGGCGG + Intergenic
1039351849 8:36772014-36772036 GCTCCTAAGTGACTAGTGGGCGG + Intergenic
1042186730 8:66143151-66143173 GTTGCTCAGTGACAAGTGGTGGG + Intronic
1044591315 8:93916849-93916871 GCTGCGCAGTGACGAGTGGGAGG - Intronic
1049225486 8:141448719-141448741 ACTGAGCAGTGACAACTGGGGGG + Intergenic
1049651212 8:143770918-143770940 GCCTCGCAGTGAGGAGGGGGCGG - Intergenic
1051739952 9:20241737-20241759 GCTGAGTAGAGAGGAGTGGGAGG + Intergenic
1051821937 9:21179797-21179819 GCTGAGCAGTGACAAGTGGCAGG + Intergenic
1051823160 9:21191859-21191881 GCTGGGCAGTGACAAGTGACAGG + Intergenic
1051824986 9:21210396-21210418 GCTGGGCAGTGACAAGTGGCAGG + Intronic
1051826977 9:21232459-21232481 GCTGGGCAGTGACAAGTGGCAGG + Intronic
1057025832 9:91733287-91733309 GCTGTGCCGCGACGAGTGCGAGG - Exonic
1057869533 9:98708033-98708055 GCTGCGAGGTACCGAGTGGGAGG - Intronic
1058250318 9:102686805-102686827 GCTACTAAGTGACTAGTGGGTGG - Intergenic
1059438803 9:114291245-114291267 GCTTCCCAGTGCCGCGTGGGAGG + Intronic
1061543950 9:131293206-131293228 GGTGAGCAGCGAGGAGTGGGGGG - Intronic
1062025425 9:134338115-134338137 GCTGGGCAGTGACCACAGGGAGG + Intronic
1203471069 Un_GL000220v1:115612-115634 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1203478890 Un_GL000220v1:159584-159606 GCTACGCCGCGACGAGTAGGAGG + Intergenic
1190526234 X:51332323-51332345 GCAGCGCAGTGGGGAGTGAGAGG + Exonic
1196245277 X:113392167-113392189 GCTGCCCAGTGATGAGTAGTGGG + Intergenic
1196736314 X:118983721-118983743 GCTCCGCGGTGAATAGTGGGTGG - Intronic
1197892341 X:131279560-131279582 GCTGCGGAGTGGGGAGGGGGCGG - Intronic
1199942391 X:152638561-152638583 GCTCCGCAGTAACAGGTGGGCGG - Intronic
1200182548 X:154159516-154159538 GCTGATCAGTGACGAGGGGCAGG + Intergenic
1200188202 X:154196630-154196652 GCTGATCAGTGACGAGGGGCAGG + Intergenic
1200193852 X:154233770-154233792 GCTGATCAGTGACGAGGGGCAGG + Intergenic
1200199607 X:154271574-154271596 GCTGATCAGTGACGAGGGGCAGG + Exonic
1200224808 X:154411634-154411656 GCTCCCCAGTGACGAGAGAGCGG + Exonic
1200411517 Y:2866574-2866596 GCTCAGCAGTGAGGAGTGGGAGG + Intronic
1202050993 Y:20780676-20780698 GCTCAGCAGTGGGGAGTGGGAGG + Intronic