ID: 1044591316

View in Genome Browser
Species Human (GRCh38)
Location 8:93916852-93916874
Sequence TTGGCTGCGCAGTGACGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591316_1044591327 18 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591316_1044591334 27 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591316_1044591329 19 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591316_1044591333 24 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591316_1044591323 0 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591316_1044591331 23 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591316_1044591325 14 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591316_1044591335 30 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591316_1044591324 13 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591316_1044591326 17 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591316 Original CRISPR TTGGCTGCGCAGTGACGAGT GGG (reversed) Intronic
904615880 1:31749357-31749379 TTGGCTGCCCAGTGGGGTGTGGG - Intronic
907020331 1:51060501-51060523 TTGCCTGCAGTGTGACGAGTGGG - Intergenic
909773100 1:79450791-79450813 TTGGCTGGCAAGTGACTAGTAGG + Intergenic
910289943 1:85589753-85589775 TTGTCTGAGCATTGAAGAGTTGG - Intergenic
917505147 1:175620627-175620649 TGGGCAGAGCAGTGGCGAGTAGG + Intronic
923765472 1:236889094-236889116 TTGGCAGAGCAGTGAGGAGCTGG + Intronic
1063551375 10:7037012-7037034 TAAGCTGTGCAGTGAGGAGTAGG + Intergenic
1064246293 10:13669966-13669988 TTGGCTGGGGAGAGACCAGTAGG - Intronic
1071847119 10:89532222-89532244 TTTACCGCGCATTGACGAGTAGG - Intronic
1074443179 10:113496648-113496670 TTGTCTGAACAGTGATGAGTTGG + Intergenic
1076114667 10:127886938-127886960 TTGCCTGGGCAGGGACGGGTGGG + Intronic
1079414481 11:20220862-20220884 TTGGCTTCTCAGTGATGGGTAGG - Intergenic
1088627763 11:111743994-111744016 TTGACTGGGCAGTGAAGATTTGG + Intronic
1093051288 12:14507818-14507840 TTTGGTGCTCAGTGACTAGTAGG - Intronic
1095331056 12:40964946-40964968 TTGTCTGGACAGTGAAGAGTGGG - Intronic
1105050803 12:133048953-133048975 TTGGCTGGTCAGTGACGGGTGGG + Intronic
1105050811 12:133048991-133049013 TTGGCTGGTCAGTGATGGGTTGG + Intronic
1113560349 13:111273802-111273824 CTTGCTGCCCAGTGAGGAGTTGG + Exonic
1114532880 14:23406362-23406384 TTGCCTGCACAGTGACTAGCGGG + Intronic
1118900283 14:69980500-69980522 TGGGCAGCGCAGTGAAGAGCAGG + Intronic
1121405224 14:93715701-93715723 TGGGGTGAGCAGTGAGGAGTGGG + Intergenic
1124349401 15:28944073-28944095 TTGGCTGCAGAGTGGAGAGTGGG - Intronic
1126418730 15:48448008-48448030 TTAGCTGCCCAGTGATGAGTAGG + Intronic
1135195276 16:20389093-20389115 TAGGCTGAGCAGTGCCCAGTGGG + Intronic
1136498757 16:30659412-30659434 GCGGCTGCACAGTGACGAGAGGG - Exonic
1141392519 16:83676611-83676633 GTGGCTGCACAGTGATGTGTCGG - Intronic
1141424004 16:83933939-83933961 GTGGCTTCCCAGTGACGTGTCGG - Intronic
1148863913 17:50618872-50618894 GGGGCTGCCCAGTGGCGAGTGGG - Exonic
1152089284 17:78237997-78238019 TTGGCTGGGCAGTGCCCAGAGGG + Intronic
1152098872 17:78289346-78289368 CTGGCTGAGGGGTGACGAGTAGG - Intergenic
1157558564 18:48630163-48630185 TGGGCTGGGCAGTGACGCGCAGG - Intronic
1160188535 18:76695622-76695644 TTTGCTGGGCAATGAAGAGTTGG + Intergenic
1160427112 18:78786119-78786141 TTGGCCCAGCAGTGAGGAGTTGG + Intergenic
1163453961 19:17395107-17395129 CTGGCTGCCCAGTGGCGAGCAGG - Intergenic
1165389515 19:35530223-35530245 GTGGCTGGGCAGAGAAGAGTGGG + Intergenic
1166737857 19:45096876-45096898 TTGGCTTGGCAGTGAGGAGTTGG + Intronic
925000089 2:398362-398384 TTTGCTGGGCACTGACGTGTCGG + Intergenic
933717101 2:85369646-85369668 TTGGCTTGGAAGTGACAAGTAGG + Intronic
945314126 2:208352265-208352287 GTGGCTGCTCAATGACAAGTGGG - Intronic
948228324 2:236330630-236330652 TTGGCTGTGCAGTCACCAGAAGG - Intronic
1174735078 20:52958383-52958405 TTGGCTATGCAGTCACGAGGGGG + Intergenic
1179594644 21:42434219-42434241 CTGGCTGCACAGTGAGGAGATGG + Intronic
1179731502 21:43370468-43370490 TTGGCGGAGCAGTGATGAGAAGG + Intergenic
1182934795 22:34210754-34210776 TTGTCTGCACAGGGACGAGAAGG - Intergenic
1184525042 22:45017425-45017447 TTGGCTGGTCAGTGACAAGACGG + Intergenic
1185066625 22:48635508-48635530 TGCGCTGCGCAGTGACGCCTGGG - Intronic
949861104 3:8505599-8505621 TTGACTGTGCAGTCACCAGTGGG + Intronic
956570610 3:70690312-70690334 TTGGCTGCTCAGTGGAGATTGGG + Intergenic
961809118 3:129511429-129511451 TTGGTGGCTCAGTGATGAGTAGG + Intronic
962236331 3:133710627-133710649 TTGGCTGCGGAGGGAGGAGGTGG - Intergenic
985428146 4:189850495-189850517 TTTGCTGCCCAGAGACGGGTGGG - Intergenic
988733312 5:33995175-33995197 TTGGCTGCTAAGTGACTAATGGG - Intronic
990774365 5:59288037-59288059 TTGTCTGGGCATTGAAGAGTTGG - Intronic
992130381 5:73685978-73686000 TTGGCTGGGTAGTGAAGTGTGGG - Intronic
993735845 5:91476385-91476407 CTGGATGGGCAGTGGCGAGTTGG + Intergenic
1001292025 5:170470459-170470481 TTGGCTGCACTGTGCCGGGTGGG - Intronic
1011732351 6:90278335-90278357 TTGGCTGGGCACTGACGAGTGGG - Intronic
1012817571 6:104043415-104043437 TTGGATACTCAGTGACAAGTTGG + Intergenic
1019929956 7:4216764-4216786 TTGGCTGGGCATTGACCAGTCGG + Intronic
1021568811 7:22043608-22043630 ATGGCTGCTAAGTGACGAGTAGG - Intergenic
1027524229 7:79246220-79246242 TTGTCTGGGCATTGAAGAGTTGG - Intronic
1030798747 7:113822679-113822701 TTGGCTGCTGAGAGAGGAGTTGG - Intergenic
1032505494 7:132431386-132431408 CTGGCTGAGGAGTGACGAGGAGG - Intronic
1034295962 7:149972680-149972702 CTGGCTGTGCAGTGATGAGCTGG - Intergenic
1034810089 7:154124222-154124244 CTGGCTGTGCAGTGATGAGCTGG + Intronic
1038664946 8:29529845-29529867 GTGGCTGTGCTGGGACGAGTGGG + Intergenic
1044591316 8:93916852-93916874 TTGGCTGCGCAGTGACGAGTGGG - Intronic
1048303276 8:133266748-133266770 TTGTCCCCGCAGGGACGAGTGGG + Intronic