ID: 1044591317

View in Genome Browser
Species Human (GRCh38)
Location 8:93916853-93916875
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591317_1044591327 17 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591317_1044591326 16 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591317_1044591335 29 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591317_1044591333 23 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591317_1044591331 22 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591317_1044591329 18 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591317_1044591324 12 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591317_1044591334 26 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591317_1044591323 -1 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591317_1044591325 13 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591317 Original CRISPR ATTGGCTGCGCAGTGACGAG TGG (reversed) Intronic