ID: 1044591317

View in Genome Browser
Species Human (GRCh38)
Location 8:93916853-93916875
Sequence ATTGGCTGCGCAGTGACGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591317_1044591325 13 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591317_1044591327 17 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591317_1044591323 -1 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591317_1044591335 29 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591317_1044591333 23 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591317_1044591331 22 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591317_1044591329 18 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591317_1044591334 26 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591317_1044591324 12 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591317_1044591326 16 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591317 Original CRISPR ATTGGCTGCGCAGTGACGAG TGG (reversed) Intronic
905645997 1:39625615-39625637 ATTGGGTGCACAGTGCAGAGGGG - Exonic
907020332 1:51060502-51060524 ATTGCCTGCAGTGTGACGAGTGG - Intergenic
1076426826 10:130372951-130372973 ATTGGCTGGACAGCGACGAACGG - Intergenic
1078145019 11:8716523-8716545 ATTTGCTGAGGAGTGAGGAGAGG - Intronic
1080684243 11:34502374-34502396 GTTGGCTGAGCAGTGCCCAGAGG + Intronic
1082688608 11:56271906-56271928 ATTGGCTACAAAGTGATGAGAGG - Intergenic
1083624337 11:64064424-64064446 ATTGCCTGCCCAGTGCCCAGAGG - Intronic
1090782108 11:130016417-130016439 ATTGCCTGGGGAGTGAAGAGAGG + Intergenic
1103899833 12:124297656-124297678 ATTAGCTGCACAGTGAAAAGGGG - Intronic
1104372230 12:128234167-128234189 CTTGGTTGTGCAGGGACGAGTGG + Intergenic
1105050802 12:133048952-133048974 GTTGGCTGGTCAGTGACGGGTGG + Intronic
1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG + Intronic
1136498758 16:30659413-30659435 GGCGGCTGCACAGTGACGAGAGG - Exonic
1138541229 16:57688969-57688991 ATTGGATGGGCAGAGACCAGGGG - Exonic
1143351603 17:6292038-6292060 ACTGGCTTAGCAGTGACCAGAGG - Intergenic
1145950390 17:28812505-28812527 ATTGGCTGTGCAGACAGGAGAGG - Intronic
1146677218 17:34781830-34781852 ATTAGCTGCGGGGTAACGAGGGG + Intergenic
1148863914 17:50618873-50618895 AGGGGCTGCCCAGTGGCGAGTGG - Exonic
1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG + Intronic
1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG + Intergenic
932816430 2:74865677-74865699 ATTTCCTGCCCAGTGACTAGAGG - Intronic
933171609 2:79131720-79131742 ATTGGCTGAGCAGTTCCTAGGGG - Intergenic
942282741 2:174383221-174383243 AGTGGCTGCTCAGTGCTGAGAGG + Intronic
1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG + Intronic
1171948830 20:31402822-31402844 ATTAGCTGGGCAGTGTTGAGTGG + Intergenic
1172211222 20:33199840-33199862 ATTGGATGCTCACTGAGGAGAGG - Intergenic
1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG + Intergenic
1180010241 21:45044697-45044719 ATTGACTGGGGAGTGACGTGAGG + Intergenic
1185066626 22:48635509-48635531 ATGCGCTGCGCAGTGACGCCTGG - Intronic
952890843 3:38039474-38039496 CTTGGGTGCGCAGCGAGGAGGGG - Exonic
971125622 4:23750872-23750894 AATGGTTGCCCAGGGACGAGAGG + Intergenic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
986411845 5:7488806-7488828 GTGGGCTGGGCACTGACGAGGGG - Intronic
990566091 5:57030913-57030935 CTTGTCTGCAGAGTGACGAGAGG + Intergenic
1000659663 5:163921505-163921527 ATTGGCTGGGAAGTGACCATTGG + Intergenic
1003967214 6:11264205-11264227 AGGGGCTGGGCAGTGGCGAGAGG + Intronic
1008680703 6:53868839-53868861 ATTTGATGCACAGTGATGAGAGG - Intronic
1011732352 6:90278336-90278358 CTTGGCTGGGCACTGACGAGTGG - Intronic
1020389177 7:7640625-7640647 ATTGGCTGCTTAGTGACGCGCGG + Exonic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1049034453 8:140063330-140063352 ATTGACTGCGTGGTGACGTGAGG - Intronic
1049790191 8:144468857-144468879 ATAGGCTGCCCAGAGAGGAGGGG - Intronic
1050475369 9:6034989-6035011 AATGGCTGTGCAGTGGGGAGAGG - Intergenic
1197002885 X:121459790-121459812 ATAGGCTGAGCAGTGATGTGGGG - Intergenic
1197892343 X:131279564-131279586 ATAGGCTGCGGAGTGGGGAGGGG - Intronic