ID: 1044591318

View in Genome Browser
Species Human (GRCh38)
Location 8:93916856-93916878
Sequence CTCGTCACTGCGCAGCCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591298_1044591318 21 Left 1044591298 8:93916812-93916834 CCCCGCCCCACCCCCGGCCGCAG 0: 1
1: 0
2: 11
3: 181
4: 1696
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591306_1044591318 9 Left 1044591306 8:93916824-93916846 CCCGGCCGCAGCCCTCTCCGCCT 0: 1
1: 0
2: 4
3: 37
4: 454
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591310_1044591318 -3 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591311_1044591318 -8 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591309_1044591318 -2 Left 1044591309 8:93916835-93916857 CCCTCTCCGCCTCCCCTCCCACT 0: 1
1: 0
2: 22
3: 251
4: 1896
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591305_1044591318 10 Left 1044591305 8:93916823-93916845 CCCCGGCCGCAGCCCTCTCCGCC 0: 1
1: 0
2: 5
3: 56
4: 737
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591302_1044591318 15 Left 1044591302 8:93916818-93916840 CCCACCCCCGGCCGCAGCCCTCT 0: 1
1: 0
2: 2
3: 47
4: 457
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591304_1044591318 11 Left 1044591304 8:93916822-93916844 CCCCCGGCCGCAGCCCTCTCCGC 0: 1
1: 0
2: 2
3: 34
4: 453
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591301_1044591318 16 Left 1044591301 8:93916817-93916839 CCCCACCCCCGGCCGCAGCCCTC 0: 1
1: 0
2: 7
3: 98
4: 967
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591299_1044591318 20 Left 1044591299 8:93916813-93916835 CCCGCCCCACCCCCGGCCGCAGC 0: 1
1: 0
2: 28
3: 499
4: 1990
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591307_1044591318 8 Left 1044591307 8:93916825-93916847 CCGGCCGCAGCCCTCTCCGCCTC 0: 1
1: 0
2: 6
3: 63
4: 658
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591296_1044591318 25 Left 1044591296 8:93916808-93916830 CCGCCCCCGCCCCACCCCCGGCC 0: 1
1: 13
2: 143
3: 1267
4: 7094
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591303_1044591318 14 Left 1044591303 8:93916819-93916841 CCACCCCCGGCCGCAGCCCTCTC 0: 1
1: 0
2: 5
3: 77
4: 859
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591300_1044591318 19 Left 1044591300 8:93916814-93916836 CCGCCCCACCCCCGGCCGCAGCC 0: 1
1: 1
2: 24
3: 262
4: 1999
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591308_1044591318 4 Left 1044591308 8:93916829-93916851 CCGCAGCCCTCTCCGCCTCCCCT 0: 1
1: 0
2: 11
3: 175
4: 1436
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1044591297_1044591318 22 Left 1044591297 8:93916811-93916833 CCCCCGCCCCACCCCCGGCCGCA 0: 1
1: 0
2: 16
3: 241
4: 2069
Right 1044591318 8:93916856-93916878 CTCGTCACTGCGCAGCCAATCGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591318 Original CRISPR CTCGTCACTGCGCAGCCAAT CGG Intronic