ID: 1044591321

View in Genome Browser
Species Human (GRCh38)
Location 8:93916864-93916886
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591298_1044591321 29 Left 1044591298 8:93916812-93916834 CCCCGCCCCACCCCCGGCCGCAG 0: 1
1: 0
2: 11
3: 181
4: 1696
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591314_1044591321 -7 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591306_1044591321 17 Left 1044591306 8:93916824-93916846 CCCGGCCGCAGCCCTCTCCGCCT 0: 1
1: 0
2: 4
3: 37
4: 454
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591301_1044591321 24 Left 1044591301 8:93916817-93916839 CCCCACCCCCGGCCGCAGCCCTC 0: 1
1: 0
2: 7
3: 98
4: 967
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591299_1044591321 28 Left 1044591299 8:93916813-93916835 CCCGCCCCACCCCCGGCCGCAGC 0: 1
1: 0
2: 28
3: 499
4: 1990
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591308_1044591321 12 Left 1044591308 8:93916829-93916851 CCGCAGCCCTCTCCGCCTCCCCT 0: 1
1: 0
2: 11
3: 175
4: 1436
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591312_1044591321 -3 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591310_1044591321 5 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591307_1044591321 16 Left 1044591307 8:93916825-93916847 CCGGCCGCAGCCCTCTCCGCCTC 0: 1
1: 0
2: 6
3: 63
4: 658
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591303_1044591321 22 Left 1044591303 8:93916819-93916841 CCACCCCCGGCCGCAGCCCTCTC 0: 1
1: 0
2: 5
3: 77
4: 859
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591311_1044591321 0 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591304_1044591321 19 Left 1044591304 8:93916822-93916844 CCCCCGGCCGCAGCCCTCTCCGC 0: 1
1: 0
2: 2
3: 34
4: 453
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591313_1044591321 -6 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591302_1044591321 23 Left 1044591302 8:93916818-93916840 CCCACCCCCGGCCGCAGCCCTCT 0: 1
1: 0
2: 2
3: 47
4: 457
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591315_1044591321 -8 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591297_1044591321 30 Left 1044591297 8:93916811-93916833 CCCCCGCCCCACCCCCGGCCGCA 0: 1
1: 0
2: 16
3: 241
4: 2069
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591309_1044591321 6 Left 1044591309 8:93916835-93916857 CCCTCTCCGCCTCCCCTCCCACT 0: 1
1: 0
2: 22
3: 251
4: 1896
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591300_1044591321 27 Left 1044591300 8:93916814-93916836 CCGCCCCACCCCCGGCCGCAGCC 0: 1
1: 1
2: 24
3: 262
4: 1999
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1044591305_1044591321 18 Left 1044591305 8:93916823-93916845 CCCCGGCCGCAGCCCTCTCCGCC 0: 1
1: 0
2: 5
3: 56
4: 737
Right 1044591321 8:93916864-93916886 TGCGCAGCCAATCGGCAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type