ID: 1044591322

View in Genome Browser
Species Human (GRCh38)
Location 8:93916871-93916893
Sequence AGTGCTTCCCGCCTGCCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591322_1044591333 5 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591322_1044591336 21 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591336 8:93916915-93916937 GGCAGGGTGGCGGCCCCGCACGG 0: 1
1: 0
2: 0
3: 12
4: 224
1044591322_1044591338 26 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591338 8:93916920-93916942 GGTGGCGGCCCCGCACGGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 49
1044591322_1044591337 25 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591337 8:93916919-93916941 GGGTGGCGGCCCCGCACGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1044591322_1044591326 -2 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591322_1044591329 0 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591322_1044591339 27 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591339 8:93916921-93916943 GTGGCGGCCCCGCACGGTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
1044591322_1044591327 -1 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591327 8:93916893-93916915 TCCGGCCCGAACGTGCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1044591322_1044591324 -6 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591322_1044591334 8 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591322_1044591325 -5 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591322_1044591335 11 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591322_1044591331 4 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591322 Original CRISPR AGTGCTTCCCGCCTGCCGAT TGG (reversed) Intronic
903742600 1:25566919-25566941 AGTGCCTCTCGCCTGTCGACTGG + Exonic
903781070 1:25820374-25820396 AGTGCTCGCCGCCTGCCCAGCGG - Exonic
908453835 1:64282438-64282460 AGTGCTTCCCGCCTCCCGCCTGG + Intergenic
919258538 1:195158210-195158232 AGTGCTTCCTGCCTGGGAATTGG + Intergenic
1064331388 10:14397377-14397399 ATTGCATCCCGCCTGCTGAGTGG + Intronic
1070825913 10:79390653-79390675 AGTGTTTTCCGTCTGCCGAGGGG - Intronic
1074678870 10:115882857-115882879 AGTGCTCCCTGCCTCCCAATGGG + Intronic
1075727371 10:124617470-124617492 AGTTCTTCCCTCCTTCCGTTCGG + Exonic
1075895962 10:125994731-125994753 TGTGCTGCCCGCCTGCCTGTTGG + Intronic
1076240394 10:128900725-128900747 AGTGCAGCCCGCCTTCGGATTGG - Intergenic
1076705006 10:132296790-132296812 TCTGCTTCCTGCCTGCTGATCGG - Intronic
1081799335 11:45847323-45847345 AGTGCCTTCCACCTGGCGATTGG - Intronic
1084007002 11:66328402-66328424 AGTGCTCCCAGCCTGCTGCTAGG - Intergenic
1090675390 11:128989424-128989446 AGTGTTTCCTGCCTGCCCTTGGG - Intronic
1095984487 12:47990460-47990482 AGTGCTTCCTGCCTGCTCAGGGG + Intronic
1102248387 12:111369161-111369183 CGTTCTTCCCACCTCCCGATTGG + Intergenic
1120441616 14:84548141-84548163 AGTACTTCCTGCCTCCAGATTGG + Intergenic
1123105249 14:105838259-105838281 AATGCTTCCTGCCTGCCCACAGG - Intergenic
1129658869 15:77542093-77542115 AGTACTCCCTGCCTGCCCATGGG + Intergenic
1131153106 15:90059321-90059343 AGTGCATCCCGCCTACCAAAAGG + Intronic
1144810971 17:17998666-17998688 TGTGCTTCCCGCCTCCCCAACGG + Intronic
1147469054 17:40640022-40640044 AGTTCTACCCGCCTCCCCATTGG - Intronic
1154400634 18:14033492-14033514 AGAGCTTCCCTCCTGCCGTCAGG - Intergenic
1156490957 18:37495770-37495792 AGTGCTTCAGGCCTGGGGATAGG - Intronic
1156823042 18:41395727-41395749 AGTGCTAACCGCCTGTTGATGGG + Intergenic
1158862491 18:61606454-61606476 AGAGCTCCCCACCTCCCGATAGG + Intergenic
1164511162 19:28898381-28898403 AGTGCTTCTTGCCTGCTGAATGG + Intergenic
926730420 2:16031970-16031992 AGTGCTGGCTGGCTGCCGATGGG - Intergenic
927908761 2:26881378-26881400 AGTGCTTCCTGCCTGCCCCCGGG + Intronic
937477676 2:122229649-122229671 TGTGCTTCCCGCCTCCCCACCGG + Intergenic
947535866 2:230940137-230940159 AGGGCCTCCCGCCTGCCCCTGGG - Intronic
1175575365 20:60056960-60056982 AGTGCTCCCCTCCTCCTGATTGG + Intronic
1180965198 22:19784569-19784591 AGTGCTGCCCGCCCGCGGATGGG + Exonic
978265263 4:106816098-106816120 AGTGCTTCCTTCCTGCAGAGGGG - Intergenic
981653824 4:147089507-147089529 CAGGCTCCCCGCCTGCCGATCGG + Intergenic
983664886 4:170169970-170169992 AGTGCTTCCAGGCTGCAGAAAGG - Intergenic
987035188 5:14011948-14011970 AGAGCTTCCGGCCTGCCACTGGG + Intergenic
1022315484 7:29241349-29241371 AGTGCTTCCCACCTGGCCTTTGG + Intronic
1023353143 7:39340026-39340048 CGTGCTTCCCGTCTGCCCCTAGG + Intronic
1028325321 7:89517519-89517541 ACTGCTTCCCTACTGCCTATTGG - Intergenic
1036989520 8:13576990-13577012 AGTGCTTACTGCTTGCTGATTGG + Intergenic
1038575880 8:28702433-28702455 AGGGCTGCCCGGCTGCTGATGGG + Intronic
1040346309 8:46501231-46501253 AGTGTTTCCCACCTGCTGAATGG + Intergenic
1044591322 8:93916871-93916893 AGTGCTTCCCGCCTGCCGATTGG - Intronic
1060921515 9:127423826-127423848 AGCAGTTCCCGCCGGCCGATAGG + Intergenic