ID: 1044591323

View in Genome Browser
Species Human (GRCh38)
Location 8:93916875-93916897
Sequence TCGGCAGGCGGGAAGCACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 108}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591313_1044591323 5 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591311_1044591323 11 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591310_1044591323 16 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591308_1044591323 23 Left 1044591308 8:93916829-93916851 CCGCAGCCCTCTCCGCCTCCCCT 0: 1
1: 0
2: 11
3: 175
4: 1436
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591306_1044591323 28 Left 1044591306 8:93916824-93916846 CCCGGCCGCAGCCCTCTCCGCCT 0: 1
1: 0
2: 4
3: 37
4: 454
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591317_1044591323 -1 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591315_1044591323 3 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591307_1044591323 27 Left 1044591307 8:93916825-93916847 CCGGCCGCAGCCCTCTCCGCCTC 0: 1
1: 0
2: 6
3: 63
4: 658
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591309_1044591323 17 Left 1044591309 8:93916835-93916857 CCCTCTCCGCCTCCCCTCCCACT 0: 1
1: 0
2: 22
3: 251
4: 1896
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591312_1044591323 8 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591305_1044591323 29 Left 1044591305 8:93916823-93916845 CCCCGGCCGCAGCCCTCTCCGCC 0: 1
1: 0
2: 5
3: 56
4: 737
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591314_1044591323 4 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591316_1044591323 0 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591304_1044591323 30 Left 1044591304 8:93916822-93916844 CCCCCGGCCGCAGCCCTCTCCGC 0: 1
1: 0
2: 2
3: 34
4: 453
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591323 Original CRISPR TCGGCAGGCGGGAAGCACTC CGG Intronic
900187205 1:1338033-1338055 TAGGCAGGCGGGAAGCAGGGTGG + Exonic
901049450 1:6419080-6419102 ACGGCAGGCGGGCAGCACGCGGG + Exonic
902245675 1:15118886-15118908 TCGGCAGGGGCTGAGCACTCTGG + Intergenic
902360868 1:15941973-15941995 TCGGCAGGCGGGGGACATTCAGG + Exonic
905485076 1:38290125-38290147 TGGGCACACAGGAAGCACTCAGG - Intergenic
912712640 1:111960815-111960837 AGGGCTGGTGGGAAGCACTCTGG - Intronic
918047531 1:180950567-180950589 TCGGAAGCCCTGAAGCACTCAGG + Exonic
920529053 1:206688397-206688419 TCCTCAGGCTGGAAGCACCCTGG - Intronic
921155646 1:212436257-212436279 GGGGCAGGCTGGAAGCCCTCAGG + Intronic
1062820987 10:534356-534378 GCGGCAGGAGGGAAGCAGCCTGG + Intronic
1063704488 10:8417706-8417728 TGGGCAGGAGGGAAGCCTTCTGG + Intergenic
1067549492 10:47223954-47223976 TGGGCAGCCGGGGAGCTCTCAGG + Intergenic
1072042140 10:91617595-91617617 TCAGAAGGTGGGAAGCACTGGGG + Intergenic
1080617033 11:33953517-33953539 CTGGCAGACAGGAAGCACTCAGG - Intergenic
1080925205 11:36749050-36749072 TCGGCATGCGGAAGCCACTCTGG + Intergenic
1083858173 11:65404222-65404244 TTGGCACGTGGGAGGCACTCAGG + Intronic
1084955644 11:72689838-72689860 TAGGCAGGCGGGAGGAAATCAGG + Intronic
1086727018 11:90198996-90199018 TGGGCAGTAGGGAAGCAGTCAGG + Intergenic
1088359486 11:108975866-108975888 TCGGCAGGTGGGAAGCTTTGTGG + Intergenic
1091883193 12:3996504-3996526 TCGCCACTCGGGAAGAACTCAGG - Intergenic
1098459248 12:70714341-70714363 TCAGGAGGCGGGAAGAACTAGGG - Intronic
1102248385 12:111369157-111369179 TCGGGAGGTGGGAAGAACGCGGG - Intergenic
1109356319 13:61233353-61233375 TAGGCAGGTGGGAAACTCTCAGG - Intergenic
1116739294 14:48734448-48734470 GCTGCAGGGGTGAAGCACTCAGG - Intergenic
1118992465 14:70809139-70809161 TAGGCAGCCGAGAAGCGCTCTGG + Exonic
1121526954 14:94625745-94625767 TGGGCTGGAGGGAAGCATTCAGG + Intergenic
1121816128 14:96930068-96930090 GCGGAATGCTGGAAGCACTCCGG - Intronic
1123028528 14:105439791-105439813 TCGGCAGGCCTGGGGCACTCGGG + Intronic
1202837251 14_GL000009v2_random:87366-87388 TCATCAGGCGGCAACCACTCAGG - Intergenic
1202906640 14_GL000194v1_random:77496-77518 TCATCAGGCGGCAACCACTCAGG - Intergenic
1128173173 15:65530731-65530753 TCGGGCGGCGGGAAGCGCGCGGG + Intronic
1128700209 15:69798512-69798534 TCGGCAGGCCAGCAGCACCCTGG + Intergenic
1129339167 15:74873560-74873582 TAGGCAGTTGGGAAGGACTCCGG - Intergenic
1129409280 15:75339926-75339948 TGGGCAGGTGGGAGGCAGTCAGG - Intronic
1132114748 15:99127182-99127204 ATGGCAGGCAGGCAGCACTCTGG + Intronic
1133232883 16:4374669-4374691 TGGGCAGGCGGGATGGATTCAGG - Intronic
1134776058 16:16854706-16854728 TTGGCAAGAGGGAAACACTCTGG - Intergenic
1138657933 16:58501406-58501428 GGCGCAGGCGGGAAGCACTGCGG - Intronic
1141300019 16:82806022-82806044 ATGGCAGGTGGGAGGCACTCTGG + Intronic
1141989458 16:87602181-87602203 TGGGAAGGCGCGCAGCACTCAGG - Intronic
1143304001 17:5931816-5931838 TCTGCAGGCGGGGAGTACTGCGG + Intronic
1144810969 17:17998662-17998684 TGGGGAGGCGGGAAGCACATGGG - Intronic
1145750714 17:27353615-27353637 TCGGAAGGCGGCCAGAACTCAGG - Intergenic
1147179417 17:38674832-38674854 GCGGGAGGCGGGAAGGACCCCGG + Exonic
1148158569 17:45437162-45437184 TCAGCAGGCGAGACGCACTGGGG + Exonic
1148564699 17:48625998-48626020 TCGGCCGGCGGGACGCCCTGGGG + Exonic
1155065804 18:22267914-22267936 TCAGGAGGCTGGAGGCACTCAGG + Intergenic
1157245067 18:46046430-46046452 TCAGCAGGCTAGAATCACTCAGG + Intronic
1157474437 18:48012269-48012291 TAGGCAGGGAGGAAGCACGCAGG + Intergenic
1160827979 19:1089610-1089632 ACAGCAGGCGGGCAGCACACGGG + Intronic
1160933318 19:1580994-1581016 TGGGGAGACGGGAAGCACGCAGG + Intronic
1162728948 19:12706165-12706187 TCGGGAGGCGGGAGCCGCTCTGG + Intronic
1163576663 19:18114903-18114925 TGGGCAGGTGGGAAGCGCTGGGG + Intronic
1163597708 19:18229978-18230000 TCAGCAGGCGACAAGCATTCAGG - Intronic
1163737500 19:18990383-18990405 TGGGCAGGCTGGCAGCACCCAGG + Intergenic
1166225350 19:41391781-41391803 CCGCCAGGAGGGAAGCAATCAGG + Intronic
1166878412 19:45912321-45912343 TAGGCAGGTGTGAGGCACTCTGG + Intergenic
1167120015 19:47511273-47511295 TTGGCGGGCGGGAATCACTCAGG - Intronic
927472139 2:23385005-23385027 GCGGCAGCCGGGAATCCCTCGGG + Intergenic
930894386 2:56428290-56428312 TCCGGAGGTGGGAGGCACTCAGG + Intergenic
941069028 2:160935530-160935552 TTGGCAGGCTGGAAACTCTCAGG + Intergenic
941986300 2:171514962-171514984 TGGTAAGGCAGGAAGCACTCAGG - Intergenic
942110237 2:172674780-172674802 TCGGGAGGGGCGAAGCCCTCGGG + Intergenic
1174960471 20:55151367-55151389 TCGGCAGGCAGGAAGCAAAAAGG - Intergenic
1176625987 21:9092295-9092317 TCATCAGGCGGCAACCACTCAGG - Intergenic
1179995864 21:44973722-44973744 AGGGCAGGCTGGAGGCACTCAGG - Intronic
952188550 3:30997489-30997511 TCGGCAGGGAAAAAGCACTCAGG + Intergenic
954210581 3:49094674-49094696 ACAGCAGGCTGGAAGCCCTCTGG - Intergenic
969694768 4:8728367-8728389 CCGGCAGGAGGGAAGCGCTGAGG - Intergenic
972505750 4:39718591-39718613 ACGGCAGGGGGGCAGGACTCAGG + Intronic
985002776 4:185502424-185502446 TCGGCACACACGAAGCACTCAGG + Exonic
985999463 5:3619230-3619252 TCTGCAGGCTGGAAGCACACCGG + Intergenic
988899279 5:35714726-35714748 TGGGCAGTAGGGAAGCAGTCAGG - Intronic
991534051 5:67647138-67647160 CTGGCACGTGGGAAGCACTCAGG + Intergenic
994125538 5:96166144-96166166 TCTGCAGGGGGGAAACACTGTGG - Intergenic
996502321 5:124230618-124230640 ATGGCCGGCGGGGAGCACTCAGG - Intergenic
999696192 5:154190498-154190520 TCGAGAGGGGGGAAGCGCTCCGG + Intronic
1000356395 5:160400053-160400075 TTTGCGGGCGGGAAGCACCCTGG - Exonic
1002103450 5:176868641-176868663 TCGGCTGGAGGGATGCCCTCCGG - Exonic
1006449060 6:34095577-34095599 CTGGCAGGCGGTAAGCACTAAGG + Intronic
1006777796 6:36609709-36609731 TTGGCATGCAGTAAGCACTCAGG + Intergenic
1007113430 6:39326924-39326946 ACGGCAGACGGGAAGCACCTGGG - Intergenic
1007165978 6:39829423-39829445 TGGGGAGGCTGGCAGCACTCAGG + Intronic
1018850674 6:167588263-167588285 TCGGCAGGCGGGAGTCTCCCGGG - Intergenic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019691722 7:2418678-2418700 TGGGCAGGAGAGAAGCATTCAGG - Intronic
1021162957 7:17298779-17298801 TCCGCAGGCGGGAAGCACCCTGG + Exonic
1024345238 7:48306567-48306589 TGGGCAGAGGGGAAGCTCTCAGG - Intronic
1026256873 7:68719948-68719970 TCCCCAGGCAGGAAGCCCTCAGG - Intergenic
1028756171 7:94436744-94436766 TTGGCAGGACGTAAGCACTCGGG + Intergenic
1033451225 7:141463832-141463854 TAGGTAGGCAGGATGCACTCAGG + Intronic
1034435548 7:151061304-151061326 CCGGCAGGAGGGAAGCAGGCTGG - Intronic
1034969310 7:155409217-155409239 TCGGCAGGCCGGCTGCCCTCCGG - Intergenic
1037870076 8:22486039-22486061 AGGGCGGGGGGGAAGCACTCAGG - Intronic
1037907808 8:22725669-22725691 TGGGAAGGGGTGAAGCACTCTGG - Intronic
1040293571 8:46137782-46137804 TGGGCAGGCGGCAGGGACTCAGG - Intergenic
1040299374 8:46180056-46180078 TGGGCAGGCAGCAAGGACTCAGG - Intergenic
1040320101 8:46288700-46288722 TCAGCAGGTTGGAAACACTCTGG - Intergenic
1040340467 8:46437952-46437974 TGGGCAGGTGGCAAGGACTCAGG - Intergenic
1040567769 8:48582592-48582614 TAGGCAGGCGGGGAGCGCTCCGG + Intergenic
1041044660 8:53879252-53879274 TGTGCAGGCGGGAAGGACTGGGG - Exonic
1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG + Intronic
1045199730 8:99967918-99967940 TCTGCAGTCAGGAAGCACTGGGG - Intronic
1045952365 8:107866115-107866137 ACGGCTGGCGGGCAGAACTCAGG + Intergenic
1052996731 9:34555203-34555225 TGGCCAGGCGGGAGGGACTCCGG + Intronic
1054465678 9:65491785-65491807 TGGACAGGCAGGAAGCACACAGG - Intergenic
1058686966 9:107488376-107488398 TGGTCAGGCAGGAAGCACCCGGG + Intronic
1062433314 9:136535456-136535478 AGGGTAGGCGGGGAGCACTCAGG + Intronic
1185792520 X:2938175-2938197 TCGGCCGGCCGGGAGCACCCCGG + Exonic
1193502489 X:82297290-82297312 TCCACAGGTGGGAAGCAATCTGG - Intergenic
1200243084 X:154507913-154507935 ACGGCAGGCGGGTAGCACCGGGG + Intronic
1201280724 Y:12339873-12339895 TCGGCTGGCTGGGAGCACCCCGG - Intergenic
1201775722 Y:17663606-17663628 TCAGCAGGTTGGAAACACTCTGG - Intergenic
1201825834 Y:18242386-18242408 TCAGCAGGTTGGAAACACTCTGG + Intergenic