ID: 1044591323

View in Genome Browser
Species Human (GRCh38)
Location 8:93916875-93916897
Sequence TCGGCAGGCGGGAAGCACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 108}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591312_1044591323 8 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591311_1044591323 11 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591306_1044591323 28 Left 1044591306 8:93916824-93916846 CCCGGCCGCAGCCCTCTCCGCCT 0: 1
1: 0
2: 4
3: 37
4: 454
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591307_1044591323 27 Left 1044591307 8:93916825-93916847 CCGGCCGCAGCCCTCTCCGCCTC 0: 1
1: 0
2: 6
3: 63
4: 658
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591316_1044591323 0 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591315_1044591323 3 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591308_1044591323 23 Left 1044591308 8:93916829-93916851 CCGCAGCCCTCTCCGCCTCCCCT 0: 1
1: 0
2: 11
3: 175
4: 1436
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591310_1044591323 16 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591309_1044591323 17 Left 1044591309 8:93916835-93916857 CCCTCTCCGCCTCCCCTCCCACT 0: 1
1: 0
2: 22
3: 251
4: 1896
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591305_1044591323 29 Left 1044591305 8:93916823-93916845 CCCCGGCCGCAGCCCTCTCCGCC 0: 1
1: 0
2: 5
3: 56
4: 737
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591317_1044591323 -1 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591313_1044591323 5 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591304_1044591323 30 Left 1044591304 8:93916822-93916844 CCCCCGGCCGCAGCCCTCTCCGC 0: 1
1: 0
2: 2
3: 34
4: 453
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108
1044591314_1044591323 4 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591323 8:93916875-93916897 TCGGCAGGCGGGAAGCACTCCGG 0: 1
1: 0
2: 1
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591323 Original CRISPR TCGGCAGGCGGGAAGCACTC CGG Intronic