ID: 1044591324

View in Genome Browser
Species Human (GRCh38)
Location 8:93916888-93916910
Sequence AGCACTCCGGCCCGAACGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591315_1044591324 16 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591311_1044591324 24 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591313_1044591324 18 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591312_1044591324 21 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591316_1044591324 13 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591317_1044591324 12 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591310_1044591324 29 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591309_1044591324 30 Left 1044591309 8:93916835-93916857 CCCTCTCCGCCTCCCCTCCCACT 0: 1
1: 0
2: 22
3: 251
4: 1896
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591314_1044591324 17 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1044591322_1044591324 -6 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591324 Original CRISPR AGCACTCCGGCCCGAACGTG CGG Intronic
901238749 1:7680976-7680998 TGCCCCCCGGCCCCAACGTGGGG - Intronic
1084026814 11:66455847-66455869 AGCACTCAGCTCCTAACGTGGGG - Intronic
1086590351 11:88508557-88508579 AGCACGCCGGCCTGCGCGTGCGG - Exonic
1130394083 15:83486937-83486959 AGCACACCGGCCCCATCATGGGG + Intronic
1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG + Exonic
1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG + Exonic
1140462210 16:75148820-75148842 GGCACGCCTGGCCGAACGTGCGG + Intronic
1141069973 16:80945316-80945338 AGCACTCCCCCACCAACGTGCGG - Intergenic
1146945104 17:36868352-36868374 CACACTCTGGCCCGAACTTGGGG - Intergenic
1148588711 17:48799441-48799463 AGCACCCCGGTCAGAACGTTTGG + Intronic
1150945732 17:69743520-69743542 AGCCCTCTGGCCAGAACTTGGGG - Intergenic
1154047144 18:10916509-10916531 AGCACTCGGGCCAGCAGGTGTGG - Intronic
1160081163 18:75728546-75728568 AGGACTCCAGCCTGAACATGAGG - Intergenic
1168724866 19:58575572-58575594 CGCACTGCGACCCGAAGGTGAGG + Intergenic
927964865 2:27262483-27262505 AGGGCTCCGGCCCGACCGAGCGG + Intronic
935595286 2:104873232-104873254 AGCTCTCCGACCCGCACGTCCGG + Intergenic
937808184 2:126169918-126169940 TGCACACCTGCCCAAACGTGAGG - Intergenic
1173229627 20:41184015-41184037 AGCACACCGGCCAGACCCTGGGG + Exonic
1177902561 21:26934639-26934661 AGTACTCAGGCCCGAATGTCAGG + Exonic
1179828741 21:43982922-43982944 AGCACACCGGCACGAACGTCAGG + Exonic
954278085 3:49555091-49555113 AGCAGTCAGGCCCGAGCGTTGGG - Intronic
960864384 3:122184608-122184630 AGGGCTCCGGGCCGAACGAGGGG + Intronic
984712997 4:182901855-182901877 AGCACTCAGGCCCTAACTTCAGG - Intronic
1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG + Intergenic
1006547387 6:34791463-34791485 AGCACTCCCTCCCAAATGTGGGG - Intergenic
1019154932 6:170032418-170032440 GGGACTCTGGCCCTAACGTGGGG - Intergenic
1040111374 8:43568473-43568495 AGCCCTCCAGCCCGAACCAGGGG - Intergenic
1044591324 8:93916888-93916910 AGCACTCCGGCCCGAACGTGCGG + Intronic
1062416871 9:136455614-136455636 AGCACTCGAGCCCGAGCGTGCGG - Exonic