ID: 1044591325

View in Genome Browser
Species Human (GRCh38)
Location 8:93916889-93916911
Sequence GCACTCCGGCCCGAACGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591317_1044591325 13 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591314_1044591325 18 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591311_1044591325 25 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591322_1044591325 -5 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591313_1044591325 19 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591316_1044591325 14 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591315_1044591325 17 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591312_1044591325 22 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1044591310_1044591325 30 Left 1044591310 8:93916836-93916858 CCTCTCCGCCTCCCCTCCCACTC 0: 1
1: 0
2: 115
3: 433
4: 2491
Right 1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591325 Original CRISPR GCACTCCGGCCCGAACGTGC GGG Intronic
903184771 1:21622687-21622709 GCGCTCGGGCCGGAACGCGCAGG - Intronic
1072744662 10:97931765-97931787 GCACTCCCGCCCGCATGAGCTGG - Intronic
1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG + Exonic
1126780219 15:52133415-52133437 GCGCTCCGGCCAGTGCGTGCAGG - Exonic
1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG + Intronic
1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG + Exonic
1137394868 16:48109792-48109814 GCACTCCTGCCCCAGCCTGCGGG - Intronic
1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG + Intronic
1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG + Exonic
935595287 2:104873233-104873255 GCTCTCCGACCCGCACGTCCGGG + Intergenic
937808183 2:126169917-126169939 GCACACCTGCCCAAACGTGAGGG - Intergenic
1184179237 22:42808635-42808657 GCCCTCTGGCCTGAAAGTGCTGG - Intronic
1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG + Intronic
973848480 4:54937220-54937242 GCACTCCAGCCTGGACGTGCAGG + Intergenic
998349455 5:141491469-141491491 GCAGTCCAGCCCCAACCTGCAGG + Exonic
1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1028796320 7:94907832-94907854 CCAGGCCGGCCCGAGCGTGCGGG + Intronic
1040492155 8:47934141-47934163 GCACTGCTGCCAGAACATGCTGG + Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1047247343 8:123157053-123157075 GCACTGCGGCCCGAGTGTCCAGG - Intergenic