ID: 1044591326

View in Genome Browser
Species Human (GRCh38)
Location 8:93916892-93916914
Sequence CTCCGGCCCGAACGTGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591315_1044591326 20 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591322_1044591326 -2 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591316_1044591326 17 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591312_1044591326 25 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591314_1044591326 21 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591317_1044591326 16 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591313_1044591326 22 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1044591311_1044591326 28 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591326 Original CRISPR CTCCGGCCCGAACGTGCGGG CGG Intronic
906556525 1:46718742-46718764 CTCCGTCCTGAACGTGAAGGGGG + Exonic
921409875 1:214823876-214823898 TCCCGGCCAGAACTTGCGGGAGG - Intergenic
1077142770 11:1031666-1031688 CTTCGGCCAGAGCGTGCGGCTGG - Exonic
1081517074 11:43843533-43843555 CTCTGGCCTGAACGTCGGGGAGG - Intronic
1083389537 11:62337740-62337762 CCCCGGCCCGGACCTGCTGGGGG - Intronic
1085423148 11:76380892-76380914 CCCCGGCCCCGACGGGCGGGCGG - Exonic
1087634562 11:100687633-100687655 CTCCGGCCCGGACGTGTCCGCGG + Intronic
1112296406 13:98191078-98191100 CTCCGGCCCGACACTGCTGGAGG + Intronic
1113797146 13:113065150-113065172 CTCCGGTCGGAAGCTGCGGGGGG + Intronic
1114035864 14:18626807-18626829 CACCGGCCCGGACGTGCCAGCGG - Intergenic
1126098243 15:45104299-45104321 CTCCTCCCAGAAGGTGCGGGAGG - Exonic
1126105982 15:45147477-45147499 CTCCTCCCAGAAGGTGCGGGAGG + Exonic
1148079586 17:44960355-44960377 CACTGGCCCGCACCTGCGGGTGG + Exonic
1152798645 17:82321092-82321114 CTCCGGCCCGACCCTCAGGGCGG + Exonic
1153069546 18:1089551-1089573 CCCTGGCCAGAACTTGCGGGAGG - Intergenic
1163314313 19:16531926-16531948 CAAAGGCCCGCACGTGCGGGAGG - Intronic
1165803266 19:38565670-38565692 TTCCGGCCCGAAGGGGCTGGCGG + Exonic
1166851455 19:45763436-45763458 CTCCGGCCCCGAGGTGTGGGTGG + Intronic
946156516 2:217810162-217810184 CTCCAGCCTGCACGTGCAGGAGG + Intronic
948939656 2:241189498-241189520 CCCCGGGGCGAAGGTGCGGGAGG + Intronic
1171010466 20:21506489-21506511 CTCCGGCCCGAGGGGGCGCGTGG + Intergenic
1175478340 20:59293003-59293025 CTCCTGCCGGAACGTGCTGATGG - Intergenic
1180459985 22:15553861-15553883 CACCGGCCCGGACGTGCCAGCGG - Intergenic
954702051 3:52455649-52455671 CTCGGGCCCGAAGGTGCGCGCGG - Exonic
966743512 3:183254438-183254460 CTCCGGCCTGCCCGCGCGGGTGG + Intronic
972214879 4:36885775-36885797 CTCCGGGCCCTACTTGCGGGTGG - Intergenic
973820324 4:54657515-54657537 CTCCCGCCCGAACGTGCTCGAGG + Intergenic
988796228 5:34656121-34656143 CTCTGGCCGGGACCTGCGGGGGG - Intergenic
1003062712 6:2875546-2875568 CTCCTTCCCGAACCTCCGGGCGG - Intergenic
1013272543 6:108558058-108558080 CGCCGGCCGACACGTGCGGGAGG - Intergenic
1016923594 6:149318257-149318279 CTCCGGGGCGTCCGTGCGGGGGG + Intronic
1019430775 7:997919-997941 CTGCGGCCCGAGGGTGTGGGCGG + Intronic
1027361803 7:77416603-77416625 CTCAGCCCCGAAGGTGCGCGCGG - Intergenic
1043303357 8:78762487-78762509 CCCCGGCCCCGACGGGCGGGCGG - Intronic
1044591326 8:93916892-93916914 CTCCGGCCCGAACGTGCGGGCGG + Intronic
1058699337 9:107587862-107587884 GTCCGGCCCTTCCGTGCGGGCGG + Intergenic
1061348354 9:130043896-130043918 GCCCGGCCAGCACGTGCGGGAGG - Intergenic
1062047864 9:134432720-134432742 CTCCTGCCCTCACGTGCCGGGGG - Intronic
1062341316 9:136095004-136095026 CGCCGGCCCGGGCGTGCGCGCGG - Intronic
1187392755 X:18896629-18896651 CTCCTGCCTGGATGTGCGGGAGG + Intronic