ID: 1044591329

View in Genome Browser
Species Human (GRCh38)
Location 8:93916894-93916916
Sequence CCGGCCCGAACGTGCGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591316_1044591329 19 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591322_1044591329 0 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591317_1044591329 18 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591314_1044591329 23 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591311_1044591329 30 Left 1044591311 8:93916841-93916863 CCGCCTCCCCTCCCACTCGTCAC 0: 1
1: 0
2: 12
3: 93
4: 1009
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591312_1044591329 27 Left 1044591312 8:93916844-93916866 CCTCCCCTCCCACTCGTCACTGC 0: 1
1: 1
2: 0
3: 34
4: 401
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591313_1044591329 24 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1044591315_1044591329 22 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591329 Original CRISPR CCGGCCCGAACGTGCGGGCG GGG Intronic
900171911 1:1273507-1273529 CCGGCCCGAGCCTGCCTGCGCGG - Intronic
900418699 1:2546422-2546444 CCGGCCTCAACGAGCGCGCGGGG - Intergenic
903184770 1:21622682-21622704 CGGGCCGGAACGCGCAGGCGCGG - Intronic
915334958 1:155135780-155135802 ACGGCCCGAGCGTGCGGGGGCGG + Intronic
915458090 1:156053751-156053773 CCGGGCCGGCCGGGCGGGCGGGG - Exonic
1074867470 10:117553374-117553396 CGGGCCGGAAGCTGCGGGCGAGG - Intergenic
1076737684 10:132466078-132466100 CCGGCCTCAACCTGCGGGCCCGG - Intergenic
1077040445 11:518835-518857 CCGCCCCGAACGCGCGAGCGAGG + Intergenic
1077514253 11:2992181-2992203 CGGGCCCGGACGGGCGGGTGGGG - Intronic
1083766725 11:64844848-64844870 CCGGCCAGGAAGTGCGGGGGCGG + Intergenic
1083890302 11:65592535-65592557 CCGGCCCGGCCGTGCCGTCGGGG - Exonic
1084588866 11:70078849-70078871 CCGGCACGCACGTGCGCGGGTGG - Intronic
1094653593 12:32399993-32400015 CCGGCGCGTAGGTGCGGGTGAGG + Intronic
1096491373 12:52014920-52014942 CCGGGCCGAAGGCGCGGGCCGGG - Exonic
1103649658 12:122422712-122422734 CCGGGCCGGCCGGGCGGGCGCGG - Intergenic
1113653876 13:112056329-112056351 CAGGCCGGAACGCGGGGGCGGGG + Intergenic
1113861750 13:113491237-113491259 TCGGGCCGGACGGGCGGGCGCGG + Exonic
1113874278 13:113584858-113584880 CCGGTCCGGCCGCGCGGGCGGGG - Exonic
1124629169 15:31327311-31327333 CCGGCCCGAGGGCGCGGCCGTGG + Exonic
1129948222 15:79560540-79560562 CCGGTCCGGCCGCGCGGGCGGGG + Intergenic
1131056611 15:89378822-89378844 CAGGCCCCAGAGTGCGGGCGCGG + Intergenic
1133037991 16:3045582-3045604 GCGGCCCCAGCGAGCGGGCGCGG + Intergenic
1136375451 16:29862773-29862795 CCGGGCCGAACGAGAGGGCGAGG - Intronic
1137708004 16:50548587-50548609 CCGGGGCGAGCGCGCGGGCGGGG - Intronic
1140462215 16:75148826-75148848 CCTGGCCGAACGTGCGGGGGCGG + Intronic
1142509630 17:385743-385765 CCGGCGCGCACGTGCGGGGAGGG - Intronic
1143503102 17:7350286-7350308 CCCGCCCGAACGTGGGTGGGCGG - Intronic
1148079588 17:44960357-44960379 CTGGCCCGCACCTGCGGGTGGGG + Exonic
1148615570 17:48997690-48997712 CAAGGCCGAACGAGCGGGCGCGG - Exonic
1152457990 17:80426999-80427021 CCGGCCCGAAGGTGGTGGCCTGG - Intronic
1153069543 18:1089549-1089571 CTGGCCAGAACTTGCGGGAGGGG - Intergenic
1153285179 18:3450060-3450082 CCGGCTGGAAGGTGCGGGGGAGG + Intronic
1157464092 18:47930205-47930227 CCGGCCCGGGCGTGCGGGTTCGG - Intronic
1160798661 19:957095-957117 CCCGCCCGAACCTGTGGGTGGGG + Intronic
1160934044 19:1584822-1584844 CCGGACCGACCCTGCGGGAGCGG - Intronic
1161030631 19:2056344-2056366 CCGGCCCGGACGTGGGTGGGTGG + Intergenic
1162315538 19:9936273-9936295 CCGGCGGGCAGGTGCGGGCGCGG - Intronic
1162612491 19:11767324-11767346 CCAGCCCCATCGTGCGGCCGAGG - Intronic
1165157345 19:33796503-33796525 CCAGCGCGAACGGGCGCGCGCGG - Intronic
945465970 2:210171173-210171195 CCGGACCGAAGGTGCGGCGGCGG - Exonic
946692303 2:222319108-222319130 TCGGCCCGAGGGTGCGGCCGCGG - Intergenic
949004300 2:241636850-241636872 CCGGCCCGAACGCGGGGGGCGGG - Intronic
949018186 2:241725320-241725342 CCCGGCCGGGCGTGCGGGCGGGG + Exonic
1178915102 21:36701545-36701567 CCGGCCCTACCGCGCGGCCGCGG + Intronic
1179605700 21:42513973-42513995 CTGCCCCGCAGGTGCGGGCGGGG - Exonic
1183856076 22:40636242-40636264 CCGGGCCGGGCGGGCGGGCGCGG - Intronic
953638734 3:44685664-44685686 CCGTCCCGGAAGTGCGGCCGGGG + Intergenic
954389183 3:50260058-50260080 GCGGCCTGAACGTGTGGGGGCGG + Intergenic
966901805 3:184492182-184492204 CCGGACTGAACCTGGGGGCGTGG - Intronic
968046152 3:195624826-195624848 CCGGCCCGAGGACGCGGGCGCGG + Intergenic
968308502 3:197665261-197665283 CCGGCCCGAGGACGCGGGCGCGG - Intergenic
969344583 4:6563128-6563150 CCCGGCTGAAGGTGCGGGCGCGG - Intronic
973820327 4:54657517-54657539 CCCGCCCGAACGTGCTCGAGGGG + Intergenic
985747159 5:1654049-1654071 CCGGCCCGAGGACGCGGGCGCGG - Intergenic
1004262066 6:14117536-14117558 CCGGCCCGGGCGCGCGGGGGCGG + Intronic
1007320852 6:41028063-41028085 CCGGCCCTAAAGTGCACGCGGGG + Exonic
1018628869 6:165805303-165805325 CCAGCCCGCAGGTGCAGGCGGGG - Intronic
1022108519 7:27213687-27213709 CCGGCCCGAGGGTGGAGGCGGGG - Intergenic
1023972259 7:45000164-45000186 CGGGCCCGGAAGTGCGGGTGTGG + Intronic
1028129450 7:87152723-87152745 CTGGCCGGAACGTGCGGGGACGG - Exonic
1034977705 7:155457869-155457891 CCGGCTAGGGCGTGCGGGCGGGG + Intergenic
1044591329 8:93916894-93916916 CCGGCCCGAACGTGCGGGCGGGG + Intronic
1057442145 9:95090602-95090624 CCGGCCCCAGGGTGCTGGCGAGG - Intergenic
1060583059 9:124770035-124770057 CCGGCCCGGGCGAGGGGGCGAGG + Intronic
1189335578 X:40168918-40168940 CCGGCCAGGGCGGGCGGGCGGGG - Intronic
1190321939 X:49184797-49184819 CAGGCCCCAGCGTGCGGTCGCGG - Intronic