ID: 1044591331

View in Genome Browser
Species Human (GRCh38)
Location 8:93916898-93916920
Sequence CCCGAACGTGCGGGCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591317_1044591331 22 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591322_1044591331 4 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591316_1044591331 23 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591315_1044591331 26 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591313_1044591331 28 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
1044591314_1044591331 27 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591331 Original CRISPR CCCGAACGTGCGGGCGGGGC AGG Intronic
900190083 1:1349521-1349543 CCCGCGCGCGGGGGCGGGGCCGG - Intergenic
900459671 1:2796869-2796891 CCCCAACGAGAGGGTGGGGCAGG - Intronic
900600114 1:3499244-3499266 CCCGTAGGTGTGGGCTGGGCAGG + Exonic
902214285 1:14924570-14924592 CCGGTAGGTGCGCGCGGGGCGGG + Intronic
903193480 1:21669147-21669169 CCCGCGCGGGCGGGCGGGGACGG - Intronic
905202442 1:36323521-36323543 CCCGAGCGGGCGGGGGCGGCCGG - Intronic
905542846 1:38773868-38773890 CCCTAAGGTGGGGGCTGGGCAGG + Intergenic
906196514 1:43933666-43933688 CCCGAAAGGTGGGGCGGGGCAGG + Exonic
906525256 1:46489875-46489897 CAGGTACGAGCGGGCGGGGCTGG + Intergenic
907261214 1:53220245-53220267 CCTGAAGGTGCGGCCGGGGCGGG - Exonic
907870498 1:58438545-58438567 CCAGAACGTGAGGGCAGGGGCGG - Intronic
908014170 1:59814732-59814754 CCCGGGGGGGCGGGCGGGGCGGG - Intergenic
908128126 1:61050444-61050466 CCCGTGAGTGCCGGCGGGGCGGG + Intronic
912442799 1:109712146-109712168 CCCGAGCGAGCGCCCGGGGCTGG - Intergenic
920695707 1:208180020-208180042 CCCCAGGGTGGGGGCGGGGCAGG - Intronic
922766357 1:228158499-228158521 CCACCACGTGCGGGCAGGGCTGG - Exonic
923519240 1:234723188-234723210 CCCGAGCCTGCGGGTGGGACAGG - Intergenic
1063448192 10:6133521-6133543 CCAGGCCGTGGGGGCGGGGCGGG - Intergenic
1067571986 10:47378359-47378381 CCAGAACTTGAGGGTGGGGCTGG - Intronic
1069372641 10:67763985-67764007 CCCGAGGGGGCGGGCGGGGGGGG + Intergenic
1069849620 10:71396723-71396745 CCCGGGGGTCCGGGCGGGGCCGG + Intergenic
1070609913 10:77926295-77926317 CCAGGACCTGCGGGCGGCGCTGG - Exonic
1070819833 10:79348171-79348193 CCCGACCGCAGGGGCGGGGCCGG - Intronic
1072700135 10:97634508-97634530 CCCGAAAGTGGGGGTGGGGGTGG + Intronic
1073030173 10:100519636-100519658 CCCGGACCCGCGGGCAGGGCAGG + Intronic
1075263104 10:120979833-120979855 CAGGAACGGCCGGGCGGGGCGGG - Intergenic
1076317430 10:129552211-129552233 CCTGAACATGTGGGAGGGGCAGG + Intronic
1076693856 10:132237636-132237658 CCTGAGTGTGCCGGCGGGGCTGG + Intronic
1076793108 10:132786934-132786956 CCCGAACGTGGGTGCGGGCTGGG + Intergenic
1077040448 11:518839-518861 CCCGAACGCGCGAGCGAGGCCGG + Intergenic
1077419825 11:2444956-2444978 CCCGAGCGCCCGGGCTGGGCCGG + Intronic
1079210386 11:18455799-18455821 CCCGCACGCGGGGGCGGGGCGGG + Intergenic
1083933383 11:65857951-65857973 CACGAAGGGGCGGGCGGTGCCGG - Intronic
1084516864 11:69642182-69642204 CCCGAACGGGCAGCCTGGGCCGG + Intronic
1091730500 12:2877039-2877061 CCCGGCGGTGCGGGCGGGGTGGG + Intronic
1096024744 12:48350911-48350933 CCGGCAGGCGCGGGCGGGGCGGG + Intronic
1096840929 12:54378982-54379004 CCCGCAGGGGCGGGCGGGGACGG + Intronic
1103339540 12:120214120-120214142 CCCGAAGGTACGGGCTGGACCGG - Exonic
1103626815 12:122226216-122226238 CCGGAACTTCCGCGCGGGGCGGG + Exonic
1107831098 13:44374163-44374185 GCGGAAGGTGGGGGCGGGGCCGG + Intronic
1112035361 13:95492277-95492299 CCATAAGGTGGGGGCGGGGCTGG + Intronic
1113417335 13:110138481-110138503 CCTGCAGGTGCGCGCGGGGCAGG + Intergenic
1113895117 13:113759309-113759331 CCCGCAGGTGAGCGCGGGGCTGG + Exonic
1114557960 14:23572462-23572484 TCTGAACGAGGGGGCGGGGCAGG - Intronic
1121629994 14:95415010-95415032 CTGGAACATGCGGGCGGGGGTGG - Intronic
1122775744 14:104116414-104116436 CCCGAACGTCCTGGCGCAGCTGG - Intergenic
1124696895 15:31870819-31870841 CGCGCACGTCCGCGCGGGGCGGG - Intergenic
1132574332 16:657665-657687 CCCGAAAGTGGGGGCAGGGGCGG + Intronic
1132604478 16:788065-788087 CCCGACGGTGGGGGCGGGGAGGG + Intronic
1132891493 16:2207019-2207041 CCGGGACCTGCGGGCCGGGCCGG - Exonic
1133020989 16:2966894-2966916 ACCGACACTGCGGGCGGGGCCGG - Exonic
1134134103 16:11668468-11668490 CCGGACCGGGCGGGCGGAGCCGG + Exonic
1136068017 16:27771666-27771688 CCAGAATGTGCTGGTGGGGCGGG - Intronic
1136505329 16:30699073-30699095 ACCCAACGTGCGCGCCGGGCGGG - Intronic
1136737042 16:32475011-32475033 TCCGAGCTTGGGGGCGGGGCAGG + Intergenic
1139664939 16:68448632-68448654 CAGGAACCTGCGGGCGGGGCCGG - Exonic
1141174047 16:81707793-81707815 CCAGAAGGAGCGGGCGGGACTGG + Intronic
1141830138 16:86505788-86505810 GCCGGCCGCGCGGGCGGGGCAGG - Intergenic
1142220230 16:88850652-88850674 GGAGAAGGTGCGGGCGGGGCCGG + Intronic
1203016029 16_KI270728v1_random:354566-354588 TCCGAGCTTGGGGGCGGGGCAGG - Intergenic
1203034364 16_KI270728v1_random:627724-627746 TCCGAGCTTGGGGGCGGGGCAGG - Intergenic
1142509637 17:385748-385770 CCCGCACGTGCGCGCCGGGGCGG + Intronic
1142810611 17:2393949-2393971 CCGGGGCGTGAGGGCGGGGCGGG + Intronic
1143672861 17:8408478-8408500 CCCGAGGGTGCGGGCTGGGGAGG + Intergenic
1144784386 17:17823711-17823733 CCCGAAGGGCGGGGCGGGGCGGG - Intronic
1147539632 17:41346497-41346519 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147541582 17:41364828-41364850 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147970910 17:44218889-44218911 CCCGCCTGTGCGGGCGGGGACGG - Intronic
1148615568 17:48997686-48997708 GCCGAACGAGCGGGCGCGGGCGG - Exonic
1148896757 17:50843387-50843409 CCTGAACGTGCGGCTGGGCCGGG + Intergenic
1151314042 17:73311187-73311209 TCCGAGGGAGCGGGCGGGGCGGG + Intronic
1151857908 17:76736514-76736536 CGGGAGCGCGCGGGCGGGGCCGG - Exonic
1153229418 18:2921991-2922013 CCCCAGCATGTGGGCGGGGCTGG - Intronic
1157464187 18:47930512-47930534 CCCGGGCCTGGGGGCGGGGCGGG - Exonic
1159952707 18:74496593-74496615 CCCGAGCGCGCGGTCGGGGGCGG + Intronic
1160749439 19:727082-727104 CCTGAAGGTACGAGCGGGGCAGG + Exonic
1160763723 19:798003-798025 CCCGGAAGCGCAGGCGGGGCTGG + Intronic
1160767046 19:813298-813320 CCCCACCGTGCAGGCGCGGCCGG - Exonic
1160798667 19:957099-957121 CCCGAACCTGTGGGTGGGGGGGG + Intronic
1161034995 19:2079605-2079627 GACGAAGGTGTGGGCGGGGCTGG - Intronic
1161424975 19:4198353-4198375 ACCGGGCGGGCGGGCGGGGCGGG + Intronic
1161430417 19:4229289-4229311 CCCGAGGGTGGGGGCGGGGGAGG - Intergenic
1161504447 19:4636348-4636370 CCGGAACCCGCGGCCGGGGCGGG - Intergenic
1162129003 19:8513939-8513961 CCCGGATGTGGGGGCGGGGTCGG + Intronic
1162323745 19:9986353-9986375 GCCGAAGGGGCAGGCGGGGCAGG - Exonic
1162380313 19:10328024-10328046 CCCGAGCTCGAGGGCGGGGCTGG + Intronic
1162932375 19:13963432-13963454 CCCGAGCCTGCAGGCTGGGCGGG - Intronic
1165056008 19:33176730-33176752 CCCGGCCGCGCTGGCGGGGCCGG + Intergenic
1166777492 19:45322007-45322029 CCGGAATGTGGGGGTGGGGCGGG - Intronic
1167072794 19:47230586-47230608 CCCCAAAGTCCGGGAGGGGCGGG - Intronic
926914377 2:17878611-17878633 CCGGGAGCTGCGGGCGGGGCGGG - Intronic
927713807 2:25340892-25340914 CCGCAATGTGGGGGCGGGGCGGG - Intronic
929756340 2:44768655-44768677 CCCGGGCGGGCGGGCAGGGCTGG - Intronic
930651656 2:53970511-53970533 CCCGGGCCTGCGGGCCGGGCCGG - Intronic
931254379 2:60556908-60556930 CCCGAAAGTGGGGGAGGGGAGGG + Intergenic
932567265 2:72917808-72917830 CGCGAGCGGGCGGGCGGGGGAGG + Exonic
933941043 2:87245411-87245433 CTCGAAGGTGAGGGTGGGGCTGG + Intergenic
936352097 2:111720601-111720623 CTCGAAGGTGAGGGTGGGGCTGG - Intergenic
936389010 2:112055209-112055231 CCCGAGCGCGGAGGCGGGGCCGG - Exonic
941905383 2:170713941-170713963 CCCGGGCGCGCGGGCGGGGAAGG - Exonic
947651077 2:231786638-231786660 CCCCAAGGCGGGGGCGGGGCGGG - Intronic
948505959 2:238427088-238427110 CCCAGACGGGCGGGCAGGGCCGG + Exonic
1173791937 20:45833761-45833783 CTCGGGCGAGCGGGCGGGGCAGG + Intergenic
1173795724 20:45857978-45858000 CCTGTAAGGGCGGGCGGGGCGGG + Exonic
1174857942 20:54064539-54064561 CCAGAACTGGCGGGCAGGGCAGG + Intronic
1179563941 21:42234809-42234831 CGCGCAGGTGCGGGCGGGGCGGG + Intronic
1179995585 21:44972562-44972584 CCCGCAGGTGCAGGCAGGGCAGG + Intronic
1180084115 21:45500022-45500044 CCCGAACGTGAGGGCTGGAGAGG + Intronic
1180557869 22:16592151-16592173 CCCGGAGCTGCGGGCGAGGCAGG + Exonic
1180782549 22:18529185-18529207 CCTGAAGGCGTGGGCGGGGCGGG + Intronic
1181126101 22:20703214-20703236 CCTGAAGGCGTGGGCGGGGCGGG + Intergenic
1181239440 22:21468523-21468545 CCTGAAGGCGTGGGCGGGGCGGG + Intergenic
1183452962 22:37906582-37906604 CCCGGGCGAGCGGGCGGCGCGGG + Intronic
1183517102 22:38272931-38272953 CCGGACTCTGCGGGCGGGGCGGG + Exonic
1183702150 22:39457049-39457071 CCAGCACGCGCGGGCGGCGCGGG + Intergenic
1184353442 22:43960920-43960942 CCTGAATGTGCGGGTGGAGCGGG + Intronic
1185171774 22:49298514-49298536 CACGAACGTGGGGGCTGGGTGGG - Intergenic
949928200 3:9058428-9058450 CCGGAAGGTGCGGGCCAGGCTGG + Exonic
949987878 3:9553880-9553902 CCCGAGCGGGCGTGCGGGACGGG + Intergenic
953562091 3:43999321-43999343 CCCGAGCGAGCGGGCGAGCCGGG - Intergenic
963798866 3:149657814-149657836 CCCGAACTTGCCGTCGGGCCTGG + Intronic
968319062 3:197749821-197749843 CCCGCGGCTGCGGGCGGGGCGGG - Exonic
968616323 4:1579257-1579279 CCAGCAGGCGCGGGCGGGGCCGG - Intergenic
968674660 4:1871183-1871205 GCCGCGCGGGCGGGCGGGGCTGG - Intergenic
971195667 4:24470663-24470685 GCCGGCCGTTCGGGCGGGGCGGG - Intergenic
973820331 4:54657521-54657543 CCCGAACGTGCTCGAGGGGCGGG + Intergenic
987340662 5:16936342-16936364 CGCGAGCGGGAGGGCGGGGCCGG - Intergenic
997749425 5:136330156-136330178 CCCCCATGTGGGGGCGGGGCAGG - Intronic
998018823 5:138753339-138753361 CCAGGAAGGGCGGGCGGGGCCGG + Intronic
1001076291 5:168630596-168630618 CTCGAAGGTGGGGGCGGGGCAGG + Intergenic
1003324834 6:5084299-5084321 CCCGAACCTGAGGCCGGGGAGGG - Intergenic
1003345297 6:5261005-5261027 CCCGAGCCTCCGGGCGGGGGCGG - Intergenic
1005805201 6:29468195-29468217 CCAGAACCTGCAGGCTGGGCTGG - Intergenic
1006271237 6:32968898-32968920 CCCGAACGGGCTGGGGGGGTGGG - Intronic
1006725555 6:36196940-36196962 CCCGAACGGTGGGGCCGGGCAGG + Exonic
1006915707 6:37592622-37592644 CACCAACGTGTGGGCAGGGCTGG + Intergenic
1011621611 6:89248918-89248940 GCCGAAGGTGAGGGCGGGGGTGG + Intergenic
1017724774 6:157269320-157269342 ACCAAACGTGCGGGCTGGCCAGG - Intergenic
1020278228 7:6637282-6637304 CCCGCGGGCGCGGGCGGGGCGGG + Intergenic
1022106412 7:27200367-27200389 GAGGAACGTGCGGGTGGGGCAGG + Intergenic
1022383924 7:29884530-29884552 CCCGGAGGGGCAGGCGGGGCGGG - Exonic
1025825357 7:65006496-65006518 CCCGAGAGAGGGGGCGGGGCTGG - Intronic
1029746440 7:102517863-102517885 CCCGCACGTGGGGCGGGGGCGGG - Intergenic
1029764377 7:102616842-102616864 CCCGCACGTGGGGCGGGGGCGGG - Intronic
1031833924 7:126659038-126659060 TCTGAACCTGGGGGCGGGGCGGG - Intronic
1032037609 7:128531619-128531641 CACGAAAGGGCGGGCGGGGGAGG - Intergenic
1034619447 7:152445854-152445876 CCCGGAGCTGCGGGCGAGGCAGG - Intergenic
1035391834 7:158509318-158509340 CCCTAACGTGCAATCGGGGCTGG + Intronic
1040559974 8:48515070-48515092 CCCGAGCCTCCGGGAGGGGCTGG - Intergenic
1043954134 8:86342400-86342422 CCTGAACGTGTGGAAGGGGCGGG - Intergenic
1044591331 8:93916898-93916920 CCCGAACGTGCGGGCGGGGCAGG + Intronic
1049166314 8:141128405-141128427 CCGGGACTTGGGGGCGGGGCCGG - Intronic
1049411448 8:142475633-142475655 GCCGTGAGTGCGGGCGGGGCGGG + Exonic
1049585119 8:143429418-143429440 CCCGGGAGCGCGGGCGGGGCCGG - Exonic
1049762587 8:144337879-144337901 CCCGGACCACCGGGCGGGGCGGG - Intergenic
1049803175 8:144527496-144527518 CCGGAGCGTGCGGGCGGCGTGGG - Exonic
1057619117 9:96619450-96619472 CCCGAGCGCCCGCGCGGGGCTGG - Exonic
1058314992 9:103554258-103554280 CACAAACGTGCTGGCAGGGCAGG - Intergenic
1060549369 9:124477805-124477827 CCCGCGGGTGGGGGCGGGGCAGG - Intronic
1062363617 9:136198814-136198836 ACCAAACCTGGGGGCGGGGCGGG + Exonic
1062496814 9:136835859-136835881 CCCGCCCGTGCGGGCGGTGTGGG + Intronic
1062618074 9:137407075-137407097 CCGGAGCGGGCGGGCGGGGGCGG + Intronic
1062662626 9:137646552-137646574 CCCGAGCGTGTGGGCTGGGGTGG + Intronic
1187904665 X:24054675-24054697 CTCGCACGGGCCGGCGGGGCGGG + Intergenic
1191606681 X:63070318-63070340 CCTGGACATGGGGGCGGGGCAGG + Intergenic
1195894681 X:109733335-109733357 CCCGGAGGGGCGGGCGGAGCGGG + Exonic
1200111645 X:153743753-153743775 TCCGAGCTTGGGGGCGGGGCAGG - Exonic
1200235868 X:154467465-154467487 GCTGAAGGTGCGGGCGGGGTGGG + Exonic
1200249817 X:154546953-154546975 ACCCCTCGTGCGGGCGGGGCGGG + Exonic