ID: 1044591333

View in Genome Browser
Species Human (GRCh38)
Location 8:93916899-93916921
Sequence CCGAACGTGCGGGCGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591315_1044591333 27 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591314_1044591333 28 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591313_1044591333 29 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591316_1044591333 24 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591322_1044591333 5 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591317_1044591333 23 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591333 Original CRISPR CCGAACGTGCGGGCGGGGCA GGG Intronic
900399572 1:2467456-2467478 CCTCACGGGCGGGCGCGGCAGGG + Intronic
905542848 1:38773869-38773891 CCTAAGGTGGGGGCTGGGCAGGG + Intergenic
906196516 1:43933667-43933689 CCGAAAGGTGGGGCGGGGCAGGG + Exonic
907261213 1:53220244-53220266 CTGAAGGTGCGGCCGGGGCGGGG - Exonic
912757628 1:112337467-112337489 CGGAACCTGAGGGCTGGGCACGG + Intergenic
1072625332 10:97107723-97107745 CAGCACGTGGGGGTGGGGCAGGG - Intronic
1074508798 10:114094828-114094850 CCTCATGTGCGGGTGGGGCAAGG - Intergenic
1077040450 11:518840-518862 CCGAACGCGCGAGCGAGGCCGGG + Intergenic
1089523108 11:119078778-119078800 TGGAACCTGCGGCCGGGGCAAGG - Exonic
1090395697 11:126416654-126416676 CCGGAGGGGCGGGCAGGGCAGGG + Intronic
1091227158 11:133964568-133964590 CCGAACGTGCGGAAGTGGCAAGG + Intergenic
1096182265 12:49557477-49557499 CCGGAGGTGCTGGCTGGGCACGG - Exonic
1100537456 12:95524370-95524392 CCCAAAGTGCTGGCCGGGCAAGG - Intronic
1107831099 13:44374164-44374186 CGGAAGGTGGGGGCGGGGCCGGG + Intronic
1113655598 13:112066608-112066630 CGGAACGCGCGGGCGGGGAGCGG + Intergenic
1114557959 14:23572461-23572483 CTGAACGAGGGGGCGGGGCAGGG - Intronic
1119996010 14:79254580-79254602 ACGAACATGCGGGCAGGCCAAGG + Intronic
1129450304 15:75647771-75647793 CCGTGCGTCCCGGCGGGGCAGGG - Intronic
1130473980 15:84247636-84247658 GCGTACGTGTGGGCGTGGCAAGG + Intergenic
1135686734 16:24503785-24503807 CCGCACCTGGGGGCCGGGCACGG + Intergenic
1136505327 16:30699072-30699094 CCCAACGTGCGCGCCGGGCGGGG - Intronic
1136737044 16:32475012-32475034 CCGAGCTTGGGGGCGGGGCAGGG + Intergenic
1138537980 16:57669893-57669915 ACAAAGGTGCGGGCAGGGCACGG + Intronic
1141116806 16:81315642-81315664 CCGCACCTGCGGGCTGGGCGAGG + Intronic
1141830136 16:86505787-86505809 CCGGCCGCGCGGGCGGGGCAGGG - Intergenic
1142220231 16:88850653-88850675 GAGAAGGTGCGGGCGGGGCCGGG + Intronic
1203016027 16_KI270728v1_random:354565-354587 CCGAGCTTGGGGGCGGGGCAGGG - Intergenic
1203034362 16_KI270728v1_random:627723-627745 CCGAGCTTGGGGGCGGGGCAGGG - Intergenic
1145921578 17:28613968-28613990 CCCAATGTGGGGGTGGGGCAGGG - Intronic
1150010116 17:61495394-61495416 CCGAGGATGCAGGCGGGGCAGGG - Intergenic
1152790331 17:82275174-82275196 GGGAACATGCGGGCTGGGCAAGG + Intergenic
1158351340 18:56567480-56567502 CCCAACCTGGGGGCAGGGCATGG + Intergenic
1160749440 19:727083-727105 CTGAAGGTACGAGCGGGGCAGGG + Exonic
1161034994 19:2079604-2079626 ACGAAGGTGTGGGCGGGGCTGGG - Intronic
1161424977 19:4198354-4198376 CCGGGCGGGCGGGCGGGGCGGGG + Intronic
1163253983 19:16143809-16143831 CAGAACGTGGGGGCTGGGCTAGG + Intronic
1163502836 19:17686776-17686798 GGGAGCGGGCGGGCGGGGCAGGG + Intronic
1163529692 19:17842265-17842287 GCCAACGTGGGGGCGGGGCTCGG - Intronic
1165867803 19:38949757-38949779 CCGAACGAGTGGGCGGGGCAAGG - Intronic
1167678427 19:50904122-50904144 CTGCACTTGCGGGCGGGGCGCGG + Intergenic
1167914050 19:52725803-52725825 CCGAACATGGTGGCGGGGCCTGG + Intronic
927216538 2:20670742-20670764 CAGAACGCGCGGGGGGGGCGCGG - Exonic
928489731 2:31769252-31769274 CCCAATGTGAGGGCTGGGCATGG + Intergenic
930872731 2:56184552-56184574 CCGAAGGCGCGGGCGCGGCGAGG - Exonic
934308425 2:91843824-91843846 TCGAGCTTGGGGGCGGGGCAGGG - Intergenic
934763890 2:96869898-96869920 CCGAACGCGAGGGCGGCGCCCGG - Exonic
934978304 2:98821823-98821845 CCGAGGGTGCGGGAAGGGCAGGG - Intronic
946329004 2:218999433-218999455 CAGAATGTGAGGGAGGGGCAAGG - Intergenic
946329487 2:219001468-219001490 CAGAAGCTGCGGGCAGGGCAAGG + Intergenic
947910939 2:233800325-233800347 CCCACTGTGCGGGTGGGGCAGGG - Intronic
948284777 2:236775069-236775091 CAGAAGGTGCGAGTGGGGCAGGG + Intergenic
948311526 2:236990433-236990455 CCTAACATGCGGGCAGGGGAAGG + Intergenic
949022213 2:241748018-241748040 CCAAACCTGCTAGCGGGGCAAGG + Intronic
1168806518 20:675297-675319 AGGGCCGTGCGGGCGGGGCAGGG - Intronic
1172177989 20:32984239-32984261 CCCATCTTACGGGCGGGGCAGGG - Intronic
1172793576 20:37522559-37522581 CTGGATGGGCGGGCGGGGCAGGG + Intronic
1180535510 22:16390904-16390926 TCGAGCTTGGGGGCGGGGCAGGG - Intergenic
1183586188 22:38754616-38754638 GGGACCGTACGGGCGGGGCAGGG - Intronic
968758018 4:2426882-2426904 CCCAAAGTGGGGGTGGGGCATGG - Intronic
969295723 4:6269833-6269855 CTGCACGAGGGGGCGGGGCAGGG - Exonic
985938662 5:3116367-3116389 CCGTAGGTGCGGGCAGTGCAGGG - Intergenic
1001076292 5:168630597-168630619 TCGAAGGTGGGGGCGGGGCAGGG + Intergenic
1002662629 5:180802368-180802390 GCGTCCGTGCGTGCGGGGCAGGG - Intronic
1003062708 6:2875539-2875561 CCGAACCTCCGGGCGGCGAACGG - Intergenic
1004229068 6:13814559-13814581 CCGGGCGCGCGGGCGGGGCTCGG + Exonic
1008263433 6:49394746-49394768 CAGAATGTGTGGGCTGGGCATGG - Intergenic
1017724772 6:157269319-157269341 CCAAACGTGCGGGCTGGCCAGGG - Intergenic
1018801099 6:167222718-167222740 CCGAACATCCGGGCTGGGGAGGG - Intergenic
1018809034 6:167284453-167284475 CCGAACATCCGGGCTGGGGAGGG + Intronic
1019279461 7:192738-192760 CCGGGCGGGCGGGCGGGGAAGGG - Intergenic
1019924078 7:4180874-4180896 CCCAACGTGCAGGTGGGGCCTGG - Intronic
1022106413 7:27200368-27200390 AGGAACGTGCGGGTGGGGCAGGG + Intergenic
1023029623 7:36080949-36080971 CCGAAAGTGGGGGCAGGGGAGGG - Intronic
1026833719 7:73624596-73624618 CCGATCGGGTGGGCGGGGCCTGG + Intergenic
1031833923 7:126659037-126659059 CTGAACCTGGGGGCGGGGCGGGG - Intronic
1032037608 7:128531618-128531640 ACGAAAGGGCGGGCGGGGGAGGG - Intergenic
1043857396 8:85277744-85277766 CCGGAAGTGAGGACGGGGCAGGG + Intronic
1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG + Intronic
1049411450 8:142475634-142475656 CCGTGAGTGCGGGCGGGGCGGGG + Exonic
1058314991 9:103554257-103554279 ACAAACGTGCTGGCAGGGCAGGG - Intergenic
1058687322 9:107489918-107489940 GCGCACGTGGGGGCGGGGGAGGG + Intronic
1062363619 9:136198815-136198837 CCAAACCTGGGGGCGGGGCGGGG + Exonic
1189336871 X:40175782-40175804 CCGGAGGTGGGGGCGGGGAACGG - Intronic
1189391564 X:40581009-40581031 CGGAACGGGCCGGCGGGACACGG - Exonic
1191053884 X:56222691-56222713 CCCACCGTGGGGGCAGGGCATGG + Intergenic
1191137655 X:57083040-57083062 TCCAACGTGCTGGCAGGGCAAGG - Intergenic
1191606682 X:63070319-63070341 CTGGACATGGGGGCGGGGCAGGG + Intergenic
1200111643 X:153743752-153743774 CCGAGCTTGGGGGCGGGGCAGGG - Exonic
1200235869 X:154467466-154467488 CTGAAGGTGCGGGCGGGGTGGGG + Exonic
1200249819 X:154546954-154546976 CCCCTCGTGCGGGCGGGGCGGGG + Exonic