ID: 1044591333

View in Genome Browser
Species Human (GRCh38)
Location 8:93916899-93916921
Sequence CCGAACGTGCGGGCGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591315_1044591333 27 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591322_1044591333 5 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591314_1044591333 28 Left 1044591314 8:93916848-93916870 CCCTCCCACTCGTCACTGCGCAG 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591317_1044591333 23 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591316_1044591333 24 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78
1044591313_1044591333 29 Left 1044591313 8:93916847-93916869 CCCCTCCCACTCGTCACTGCGCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1044591333 8:93916899-93916921 CCGAACGTGCGGGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591333 Original CRISPR CCGAACGTGCGGGCGGGGCA GGG Intronic