ID: 1044591334

View in Genome Browser
Species Human (GRCh38)
Location 8:93916902-93916924
Sequence AACGTGCGGGCGGGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 453}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591322_1044591334 8 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591317_1044591334 26 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591315_1044591334 30 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591316_1044591334 27 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591334 Original CRISPR AACGTGCGGGCGGGGCAGGG TGG Intronic