ID: 1044591334

View in Genome Browser
Species Human (GRCh38)
Location 8:93916902-93916924
Sequence AACGTGCGGGCGGGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 453}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591316_1044591334 27 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591317_1044591334 26 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591322_1044591334 8 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453
1044591315_1044591334 30 Left 1044591315 8:93916849-93916871 CCTCCCACTCGTCACTGCGCAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591334 Original CRISPR AACGTGCGGGCGGGGCAGGG TGG Intronic
900564193 1:3324327-3324349 GACTGGCAGGCGGGGCAGGGTGG - Intronic
900622600 1:3594139-3594161 AGCGTGCTGGCGGGACATGGTGG + Intronic
901426184 1:9183323-9183345 ACCGTGCGCGCAGGGCAGCGTGG - Intergenic
902214287 1:14924574-14924596 TAGGTGCGCGCGGGGCGGGGCGG + Intronic
902430770 1:16361409-16361431 AATGTGCAGGCTGGGCATGGTGG - Intronic
902452174 1:16503436-16503458 ACCGTTAGGGCTGGGCAGGGTGG - Intergenic
902720146 1:18298531-18298553 AACAGCTGGGCGGGGCAGGGTGG + Intronic
903029122 1:20450261-20450283 AAGGTGCAGGAGGGGCAGGAGGG + Intergenic
903136308 1:21311383-21311405 AGCATGCGGGCCGGGCATGGGGG + Intronic
904753418 1:32754925-32754947 ACCGTGGGGACGGGGGAGGGGGG - Intronic
905515622 1:38559818-38559840 GGCGAGCGGGCGGGGCGGGGCGG + Intergenic
906031059 1:42720406-42720428 AAGGTGAGGGCTGGGCATGGTGG + Intergenic
906128843 1:43443777-43443799 CACCTGCGGGCGGGTGAGGGGGG - Exonic
906317985 1:44800402-44800424 CACGCGCGGCCGGGGCCGGGCGG + Exonic
906384181 1:45353183-45353205 AAAGTGCAGGCCGGGCATGGTGG - Intronic
906525258 1:46489879-46489901 TACGAGCGGGCGGGGCTGGCGGG + Intergenic
907160540 1:52365986-52366008 GCGGCGCGGGCGGGGCAGGGCGG - Intronic
907220513 1:52904101-52904123 AACATGTGGGCTGGGCAGGGTGG - Intronic
908473427 1:64467401-64467423 AATGTCAGGGCGGGGAAGGGGGG + Intergenic
909012335 1:70348555-70348577 AAGGTGCAGGCTGGGCATGGTGG - Intronic
912008294 1:104930960-104930982 AGGGTGTGGGTGGGGCAGGGAGG + Intergenic
912757629 1:112337470-112337492 AACCTGAGGGCTGGGCACGGTGG + Intergenic
913452863 1:119003877-119003899 AAGGTGGGGTGGGGGCAGGGGGG + Intergenic
915125004 1:153657737-153657759 AACATGCAGGCAGGGCATGGTGG - Intergenic
915134701 1:153722461-153722483 AACGTGTGGGCCAGGCATGGTGG - Intergenic
915339109 1:155166744-155166766 GCCGTGCTGGCGGGTCAGGGCGG - Intergenic
915393254 1:155562839-155562861 GCCGTGGGGGCGGGGAAGGGGGG - Intergenic
915461313 1:156072294-156072316 AGGGTGCGGGTGGGGAAGGGGGG - Exonic
915606678 1:156956400-156956422 AAGGTGAGGGCCGGGCATGGTGG - Exonic
916090599 1:161305574-161305596 GAGGTGAGGGCAGGGCAGGGCGG + Exonic
916437271 1:164788746-164788768 AAAGGGCGGGGGGGGGAGGGCGG - Intronic
916490110 1:165294674-165294696 TACATGCGGGCTGGGCACGGTGG + Intronic
917050531 1:170917472-170917494 AACGTGTGGGTGAGGCAGGAAGG + Intergenic
917413429 1:174783437-174783459 TACGGGCGGCGGGGGCAGGGTGG - Intronic
917830813 1:178883696-178883718 AAGTTGCTGGCCGGGCAGGGTGG + Intronic
918215958 1:182391989-182392011 GGCGTGGGGGAGGGGCAGGGCGG + Exonic
919648404 1:200119894-200119916 AAAGTGCTGGCCGGGCACGGTGG - Intronic
920225648 1:204437021-204437043 ATCATGCGGTGGGGGCAGGGGGG - Intronic
920228953 1:204457744-204457766 TGCATGCGGGAGGGGCAGGGGGG + Exonic
920611084 1:207438546-207438568 AATGTGGGGGCCGGGCACGGTGG + Intergenic
920917847 1:210272583-210272605 AATGTGGGGGCGGGGGAAGGGGG + Intergenic
921189875 1:212699786-212699808 GGCGCGCGGGCGGGGCGGGGCGG - Exonic
922478035 1:225920370-225920392 ATGGTGGGAGCGGGGCAGGGGGG + Exonic
922815593 1:228446669-228446691 CCCGTGGGGGCGGGGCGGGGTGG + Intergenic
922947045 1:229525551-229525573 AACATGTGGGCTGGGCACGGTGG + Intronic
923285934 1:232495274-232495296 AAGGTGGGGGCCGGGCACGGTGG + Intronic
924560595 1:245154529-245154551 AACTTGGGGGCGGGGGAGGCTGG + Intergenic
1063664515 10:8053487-8053509 ACCGAGCGGGCGGTGCAGGTTGG + Intergenic
1064017491 10:11783854-11783876 GCCTTGTGGGCGGGGCAGGGTGG - Intergenic
1065097216 10:22293345-22293367 AACTTGCAGGCCGGGCACGGTGG - Intergenic
1067222707 10:44355596-44355618 AACGTGAAAGAGGGGCAGGGAGG + Intergenic
1068217239 10:53998762-53998784 AACGTGTAGGCTGGGCACGGTGG + Intronic
1068731471 10:60363073-60363095 GGCGGGCGGGCGGGGGAGGGGGG + Intronic
1069453365 10:68534920-68534942 AAAGTCTGGGCGGGGCATGGTGG - Intergenic
1071532706 10:86401466-86401488 GACGTCCGGGCGGGGTGGGGAGG - Intergenic
1071618234 10:87095134-87095156 AACGGACGGGAGGGGCAGGGAGG + Intronic
1072318797 10:94228892-94228914 AACGTGTAGGCCGGGCACGGTGG + Intronic
1072435260 10:95408576-95408598 AAAGGGGGGGGGGGGCAGGGAGG + Intronic
1073289967 10:102408738-102408760 CACGGGCTGGGGGGGCAGGGAGG - Intronic
1074369821 10:112891229-112891251 AACGTGGTGGCTGGGCATGGTGG - Intergenic
1074801513 10:117005280-117005302 CACCTGCAGGCGGGGCGGGGCGG + Exonic
1075119618 10:119654961-119654983 AACATGGGGTTGGGGCAGGGAGG - Intronic
1075263102 10:120979829-120979851 AACGGCCGGGCGGGGCGGGGCGG - Intergenic
1076120271 10:127931076-127931098 AACTGGCGGGCCGGGCACGGTGG - Intronic
1077121675 11:911546-911568 AACGGCTGAGCGGGGCAGGGTGG - Intronic
1077412202 11:2408839-2408861 AGCGTGCAGGCTGGGGAGGGAGG - Intronic
1077551869 11:3204075-3204097 AGAGTGGGGGCTGGGCAGGGAGG - Intergenic
1077626837 11:3779838-3779860 AAAGTGCTGGCCGGGCACGGTGG + Intronic
1077665593 11:4105735-4105757 AGATTGGGGGCGGGGCAGGGTGG + Intronic
1077886253 11:6390298-6390320 CCCGTGCGCCCGGGGCAGGGCGG + Intergenic
1078219292 11:9338026-9338048 AATGTGCGGGCTGGGCCCGGTGG + Intergenic
1078317569 11:10305610-10305632 ACCGCCCGGGCGGGGCACGGAGG - Exonic
1079163101 11:18012767-18012789 AGCGGGCGGGCGGGGAAGGAAGG - Intronic
1079906864 11:26259568-26259590 AACGTGGGGGTGGGGGTGGGGGG + Intergenic
1080897745 11:36460436-36460458 ATCATGGGAGCGGGGCAGGGAGG - Intronic
1081177220 11:39943903-39943925 AAGGTGAGGGCTGGGCACGGTGG - Intergenic
1083360263 11:62102324-62102346 AAAGTGCTGGCCGGGCATGGTGG - Intergenic
1083449565 11:62734009-62734031 AATGAGGGGGCTGGGCAGGGTGG + Intronic
1083672198 11:64305792-64305814 CATGTGCGAGCGCGGCAGGGAGG + Intronic
1083707546 11:64526574-64526596 CAGGAGCAGGCGGGGCAGGGAGG - Intergenic
1083827060 11:65209947-65209969 CAGGTGCGGGCCGGGCAGGTGGG + Intronic
1084777464 11:71387041-71387063 TCCGTGTGGGCGGGGCAGGGGGG - Intergenic
1086040816 11:82476051-82476073 AAAGAGCAGGCTGGGCAGGGTGG - Intergenic
1087247147 11:95852748-95852770 CACGTGCTGGCCGGGCACGGTGG + Intronic
1088481077 11:110296734-110296756 AGCCTGCGGGAGGGGCGGGGCGG - Intergenic
1088504584 11:110515660-110515682 AAAGTAAGGGCGGGGCACGGTGG + Intergenic
1088735463 11:112724608-112724630 GAGGTGGGGGCGGAGCAGGGAGG - Intergenic
1089090956 11:115874801-115874823 CACGTACAGGCTGGGCAGGGTGG - Intergenic
1090666495 11:128918206-128918228 ACCGGGAGGGCTGGGCAGGGAGG + Exonic
1090859653 11:130641400-130641422 AACGTCCGGGCCGGGCGCGGTGG - Intergenic
1091227159 11:133964571-133964593 AACGTGCGGAAGTGGCAAGGAGG + Intergenic
1091428786 12:414615-414637 CATGTGCGGGTGGGGAAGGGAGG - Intronic
1091473571 12:752179-752201 AACGAGCGGGCGGGGGGTGGGGG - Intergenic
1091497759 12:987254-987276 AACTGGCGGGCTGGGCACGGTGG - Intronic
1091684314 12:2550689-2550711 ACCTGGGGGGCGGGGCAGGGCGG + Intronic
1091743360 12:2975673-2975695 AATGTGCTGGCTGGGCACGGTGG - Intronic
1093310898 12:17583253-17583275 AATGTGCTGGCCGGGCGGGGTGG + Intergenic
1094569337 12:31628138-31628160 AACCTGGCGGCGGGGCAGTGTGG - Intergenic
1095452734 12:42349972-42349994 GACGTGGTGGCGGGGCAGAGGGG + Intronic
1096024746 12:48350915-48350937 CAGGCGCGGGCGGGGCGGGGCGG + Intronic
1096680407 12:53252049-53252071 GGCGGGCGGGCGGGGCGGGGCGG + Intronic
1098834152 12:75400407-75400429 AACGTTCAGGCCGGGCACGGTGG - Intronic
1098973512 12:76879087-76879109 ATCCGGCGGGCGGGGCTGGGAGG - Intergenic
1098991177 12:77065838-77065860 AAGGTGGGGGCGGCGCGGGGCGG + Intergenic
1099341730 12:81445202-81445224 AAGGTGGGGGGGGGGGAGGGGGG + Intronic
1100537454 12:95524367-95524389 AAAGTGCTGGCCGGGCAAGGTGG - Intronic
1101905013 12:108817910-108817932 AACTTGCTGGCTGGGCACGGTGG + Intronic
1101910461 12:108857338-108857360 GCCGCGCGTGCGGGGCAGGGGGG - Intronic
1102275321 12:111577550-111577572 AACATGCGGGCCGGGCCCGGTGG - Intronic
1102516080 12:113447804-113447826 AACGTGCGAGGAGGCCAGGGTGG + Intergenic
1102862688 12:116350282-116350304 AAGGTGGGGGCTGGGCATGGTGG - Intergenic
1102869742 12:116404601-116404623 AAAGTGCGGGCTGGGCGCGGTGG + Intergenic
1102970628 12:117163243-117163265 AACTTGCAGGCCGGGCACGGTGG + Intronic
1103481688 12:121254169-121254191 AACGTGGTGGCCGGGCACGGTGG + Intronic
1103538370 12:121649232-121649254 AAAGTGGGGGCAGGGCATGGTGG - Intergenic
1103563869 12:121805749-121805771 GAGTTGCGGGCGGGGCGGGGGGG + Intronic
1104372421 12:128235530-128235552 AACGTATAGGCTGGGCAGGGAGG - Intergenic
1104420519 12:128630745-128630767 AATGTGTGGGCCGGGCACGGTGG + Intronic
1104961445 12:132490240-132490262 GCCGAGCGGGCGGGGCCGGGCGG - Exonic
1105011982 12:132762012-132762034 GACGGGCGGGCGCGGCAGGCGGG + Intergenic
1105354948 13:19651810-19651832 AACATGAGGGCTGGGCACGGCGG + Intronic
1105389173 13:19959108-19959130 AGAGTGCGGGCGAGGCCGGGAGG + Intronic
1105442570 13:20427594-20427616 AAGGGGCGGGGGTGGCAGGGAGG - Intronic
1105512452 13:21061670-21061692 CACGGCCGGGCGGGGCTGGGCGG - Intergenic
1105869160 13:24488639-24488661 AAAGTCCGGGCCGGGCATGGTGG - Intronic
1106042487 13:26106471-26106493 AACATGCTGGCTGGGCATGGTGG - Intergenic
1107125362 13:36840251-36840273 AAAGAGCGGGAGTGGCAGGGCGG - Intergenic
1107831100 13:44374167-44374189 AAGGTGGGGGCGGGGCCGGGCGG + Intronic
1107893744 13:44937600-44937622 AAGGTGGGGGCGGGGGAGGGAGG + Intergenic
1108313919 13:49220245-49220267 AGCGTGCGGGCTGGGAAAGGAGG + Intergenic
1109182251 13:59228026-59228048 AACGTGCAGGCAAGGCAGGATGG + Intergenic
1111580918 13:90222486-90222508 TACGGGCGGGCGGGGGAGGGGGG + Intergenic
1113417337 13:110138485-110138507 CAGGTGCGCGCGGGGCAGGCGGG + Intergenic
1114532140 14:23402873-23402895 AAAGGGAGGGAGGGGCAGGGAGG + Intronic
1115211014 14:30967221-30967243 AAAGAGAGGGTGGGGCAGGGTGG + Intronic
1115445055 14:33480528-33480550 AGGGTGGGGGCGGGGCGGGGAGG - Intronic
1117012645 14:51486319-51486341 AACTTGCAGGCCGGGCATGGTGG - Intergenic
1119996011 14:79254583-79254605 AACATGCGGGCAGGCCAAGGAGG + Intronic
1121710585 14:96035968-96035990 AAAGAGTGGGTGGGGCAGGGAGG + Intergenic
1122771014 14:104097652-104097674 CACGTGGAGGCGGGGCAGGTGGG + Intronic
1122887526 14:104716977-104716999 AAGGTGGGGGCTGGGCACGGTGG - Intronic
1122959512 14:105088060-105088082 TGCCTGCGGGCAGGGCAGGGAGG + Intergenic
1124393079 15:29277497-29277519 AAGGTGCGGGAGTGGGAGGGTGG + Intronic
1124496967 15:30192697-30192719 GGCGTGCGGGCGGGGGTGGGAGG + Intergenic
1124687587 15:31795659-31795681 AACGTGCAGGCCGGGGAGAGTGG - Intronic
1124746609 15:32345950-32345972 GGCGTGCGGGCGGGGGTGGGAGG - Intergenic
1124848238 15:33311550-33311572 AAGGAGCCAGCGGGGCAGGGGGG + Intronic
1125544015 15:40489339-40489361 AAGGAGGGGGCGGGGCGGGGGGG + Intergenic
1125709346 15:41772340-41772362 AATGTGTGGGCCGGGCATGGTGG + Intronic
1125731321 15:41894168-41894190 AAGTTGCTGGCGGGGAAGGGAGG - Intergenic
1126668736 15:51096602-51096624 AAAGTGGGGGCCGGGCACGGTGG + Intronic
1127629726 15:60815652-60815674 TAAGTGGTGGCGGGGCAGGGAGG - Intronic
1128030498 15:64475676-64475698 AACATGCGGGCTGGGCGCGGTGG - Intronic
1128061195 15:64736963-64736985 CACGTGTGGGCAGGGCAGGGTGG + Intergenic
1128171484 15:65517489-65517511 ACGGTCCGGGCGGGGCCGGGGGG - Intronic
1128486633 15:68097718-68097740 AACATGCAGGCTGGGCACGGTGG - Intronic
1128511647 15:68317227-68317249 AATGTGGGGGAGGGTCAGGGTGG - Intronic
1129284651 15:74514767-74514789 AAACTGCAGGCGGGGCACGGTGG + Intergenic
1131200064 15:90388474-90388496 GCCGGGCGGGTGGGGCAGGGCGG + Intronic
1131469069 15:92680138-92680160 AACTTCCGGGCCGGGCACGGTGG - Intronic
1132478499 16:154139-154161 GCGGTGCGGGCGGGGCGGGGCGG + Intronic
1132480570 16:164698-164720 GCGGTGCGGGCGGGGCGGGGCGG + Intronic
1132776091 16:1594996-1595018 AACTTGCAGGCCGGGCACGGTGG + Intronic
1132944723 16:2526608-2526630 AACCTGGGGGCGGGGTTGGGGGG - Intronic
1133126077 16:3646837-3646859 ATGGTGCGGGCGGGGCTGAGGGG + Intronic
1133227558 16:4349240-4349262 AAAGTGCTGGCCGGGCACGGTGG - Intronic
1133390975 16:5409757-5409779 AACATGCAGGCTGGGCATGGTGG + Intergenic
1133801898 16:9091571-9091593 AGCATGTGGGCGGGGTAGGGCGG + Intergenic
1135080568 16:19431251-19431273 AACGTGGGGGCCGGGCGCGGTGG + Intronic
1136400465 16:30014650-30014672 AAAGTGCAGGCTGGGCATGGTGG + Intronic
1136520014 16:30789244-30789266 AAAGTCCGGGCAGGGCACGGTGG + Intergenic
1136625452 16:31459297-31459319 GACGTGCGGGCGGTGCATGAGGG - Exonic
1137657560 16:50173229-50173251 AAAGAGCTGGCAGGGCAGGGTGG - Intronic
1138475217 16:57266583-57266605 GAGGTGAGGGAGGGGCAGGGAGG + Intronic
1139412353 16:66774166-66774188 AACGTTTGGGCTGGGCATGGTGG - Intronic
1139664937 16:68448628-68448650 AACCTGCGGGCGGGGCCGGAGGG - Exonic
1139869962 16:70099516-70099538 AACTTTCAGGCGGGGCACGGTGG - Intergenic
1140470424 16:75210882-75210904 CAGGTGCGGGCCGGGCATGGTGG - Intergenic
1140998859 16:80288977-80288999 AACGTAAGGGTGGGGCGGGGGGG + Intergenic
1141678743 16:85531617-85531639 AGTGTGGGGCCGGGGCAGGGCGG - Intergenic
1142006424 16:87691488-87691510 GGCGTGTGGGCCGGGCAGGGGGG + Intronic
1142084110 16:88167347-88167369 AATCTGCGAGCGGGGCATGGTGG - Intergenic
1142235578 16:88921046-88921068 AGGGTGGGGGCGGAGCAGGGAGG - Intronic
1142422846 16:89983181-89983203 AAAGTGCGGGCTGGGCACAGTGG - Intergenic
1142986026 17:3695822-3695844 AAGGCGGGGGAGGGGCAGGGCGG - Intronic
1143749942 17:9021140-9021162 AGCGCGCGGGCGGGGGAAGGGGG - Intergenic
1144338578 17:14294986-14295008 AAAGTGCAGGCTGGGCACGGTGG - Intergenic
1144800319 17:17921741-17921763 AAAGTGGGGGCGGGGTGGGGGGG + Intronic
1145064754 17:19754709-19754731 AACGTGTGGGCTGGGCGCGGTGG - Intergenic
1145077401 17:19867443-19867465 GACGGGCGGGCGGCGCAGTGCGG + Exonic
1145227522 17:21142683-21142705 AACGGCGGGGCGGGGGAGGGGGG - Intronic
1145817472 17:27805900-27805922 AACGGGAGGGCAGGGAAGGGAGG - Intronic
1145921576 17:28613965-28613987 AATGTGGGGGTGGGGCAGGGAGG - Intronic
1146581179 17:34040047-34040069 AGAGGGCGGGCGGGGGAGGGGGG + Intronic
1147604975 17:41769376-41769398 AGGGTGGGGGCTGGGCAGGGAGG - Intronic
1148264383 17:46213593-46213615 AACGTTTGGGCCGGGCACGGTGG - Intronic
1148593040 17:48830973-48830995 GACGTGTGGGCGGGGCAGGCGGG + Intronic
1148671819 17:49416070-49416092 AACGTGAGGGCTGGGCGTGGTGG + Intronic
1149318999 17:55465985-55466007 AAAGTGCTGGCAGGGCATGGTGG + Intergenic
1150045814 17:61912363-61912385 AAGGTGGGGGCGGGGGGGGGGGG + Intronic
1150108586 17:62479099-62479121 AGAGGGCGGGCGGGGGAGGGGGG - Exonic
1150154834 17:62844355-62844377 AACATGCAGGCTGGGCACGGTGG + Intergenic
1150728528 17:67671171-67671193 AACATGCCGGCCGGGCACGGTGG - Intronic
1151637743 17:75363570-75363592 AACTAGCGGGCCGGGCATGGTGG + Intronic
1151695764 17:75716276-75716298 AACGTGGGGGCCGGGCACAGTGG + Intergenic
1151732913 17:75921642-75921664 GACATGGGGACGGGGCAGGGTGG + Intronic
1151788653 17:76289648-76289670 AAAGTGGGGGCTGGGCACGGTGG + Intronic
1152100681 17:78300214-78300236 AACGTCCAGGCTGGGCATGGTGG - Intergenic
1152201280 17:78947858-78947880 ACCAGGCTGGCGGGGCAGGGTGG + Intergenic
1152353829 17:79797473-79797495 AACTTGGTGGCGGGGGAGGGGGG - Intronic
1153008331 18:515351-515373 AACGTGCCTGCGGGGCCGGGCGG - Intergenic
1154111982 18:11578012-11578034 AGCATGCTGGAGGGGCAGGGAGG + Intergenic
1154351333 18:13586119-13586141 AAACTGAGGGCGGGGCATGGTGG + Intronic
1155529083 18:26747317-26747339 ACGGTGCGGGGGGGGCGGGGGGG + Intergenic
1155638683 18:27986026-27986048 AATGGGCAGGAGGGGCAGGGAGG - Intronic
1155654698 18:28178480-28178502 CACCTGCGGGCGGGGGAGGGCGG + Intergenic
1155958085 18:31970819-31970841 TACGTGGGGGTGGGGCAGGGAGG - Intergenic
1156331580 18:36128996-36129018 ATCCTGCGGACCGGGCAGGGGGG - Intronic
1156431659 18:37081267-37081289 AATGTCCTGGCGGGGCACGGTGG - Intronic
1157310631 18:46550284-46550306 AGCGTGTGGGCCGGGCACGGTGG + Intronic
1157448647 18:47768417-47768439 AACATGCGGGCCGGGCGCGGTGG + Intergenic
1157956421 18:52102310-52102332 AAAGTGGGGGCCGGGCATGGTGG - Intergenic
1158426778 18:57347500-57347522 AAAGAGAGGACGGGGCAGGGAGG - Intergenic
1158637821 18:59177020-59177042 AAGAAGCGGGAGGGGCAGGGAGG + Intergenic
1159798533 18:72869345-72869367 CACGTGCGCGCGGGGCTGCGCGG + Intergenic
1160155245 18:76428991-76429013 GGCGAGCGGGCAGGGCAGGGAGG + Intronic
1160702360 19:513955-513977 AATGTGGGGCCGGGGCAGGTTGG - Intronic
1160818246 19:1046210-1046232 AACCTGCGAGAGGGGCATGGTGG - Exonic
1160941452 19:1622120-1622142 ACCGGGCGGGAGGGGCAGCGGGG + Exonic
1160961365 19:1722772-1722794 AACATGGGGGCTGGGCATGGTGG + Intergenic
1161492747 19:4571343-4571365 AAGATGCGGGCAGGGCACGGTGG - Intergenic
1161681006 19:5679761-5679783 AACCTGCGGGCAGGGACGGGAGG + Exonic
1161703124 19:5805458-5805480 AAGGGGCAGGCGGGGCAGGTGGG + Intergenic
1161769607 19:6224044-6224066 GACATGCGGGAGGGGCAGGCTGG + Intronic
1161924728 19:7292454-7292476 CACCTGGGGGCGGGGCTGGGGGG + Intronic
1161948070 19:7451278-7451300 CACGGGCGGGCGGGGCAGTGGGG - Intronic
1162323743 19:9986349-9986371 AAGGGGCAGGCGGGGCAGGCTGG - Exonic
1162447370 19:10731639-10731661 AACCTGGGGGCCGGGCACGGCGG - Intronic
1162597320 19:11639579-11639601 ATGGGGCGGGCGGGGGAGGGGGG - Intergenic
1162933594 19:13969362-13969384 CACGTGTGGGCCGGGCACGGTGG + Intronic
1163129342 19:15262889-15262911 CACGTGTGGGCGGGGAGGGGAGG - Intronic
1163146079 19:15380004-15380026 GCCGCGCGGGCGGGGCGGGGTGG - Intergenic
1163306952 19:16486332-16486354 AAAGTGTGGGCTGGGCATGGTGG + Intronic
1163399557 19:17083936-17083958 AATGTGCGGGCTGGGCATGGTGG - Intronic
1163642226 19:18468400-18468422 GAGGTGCAGGCAGGGCAGGGTGG - Intronic
1163775170 19:19213128-19213150 GACGTGGGGGCAGGGCAGGCAGG + Intronic
1163825521 19:19522015-19522037 AAAGTCCGGGCTGGGCACGGTGG + Intronic
1163858957 19:19730312-19730334 AAACTGCGGGCTGGGCACGGTGG - Intronic
1164160486 19:22623088-22623110 AGGGTGCGGGCGGGGCGGGCGGG + Intergenic
1164579313 19:29424728-29424750 GACGTGCTGGCTAGGCAGGGAGG - Intergenic
1165048971 19:33129283-33129305 AACTTGGGGGCTGGGCATGGTGG + Intronic
1165319127 19:35075077-35075099 AAGGGGTGGGCGGGGCATGGGGG - Intergenic
1165355157 19:35299858-35299880 TGGGTGCGGGCGGGGCGGGGTGG + Intronic
1165394752 19:35558161-35558183 AAGCTGTGGGCGGGGCTGGGTGG + Intronic
1165733781 19:38163200-38163222 AAAGTGCGGGCTGGGCGCGGTGG + Intronic
1166000716 19:39875929-39875951 GACCTGCGGGCGGGGGATGGCGG + Exonic
1166107333 19:40603873-40603895 GAGGTGCGGCGGGGGCAGGGCGG - Intronic
1166575082 19:43829734-43829756 AAAGTGGGGGCTGGGCACGGTGG + Intronic
1167028428 19:46939698-46939720 AAGGTGCAGGCCGGGCATGGTGG - Intronic
1167072788 19:47230582-47230604 AAAGTCCGGGAGGGGCGGGGGGG - Intronic
1167509908 19:49890598-49890620 TACCTGCAGGCGGGGCGGGGCGG + Exonic
1167590886 19:50403595-50403617 AAGGTGAGGGCTGGGCAGGTGGG + Exonic
1167678428 19:50904125-50904147 CACTTGCGGGCGGGGCGCGGTGG + Intergenic
1167687461 19:50965563-50965585 AAAGTGAGGGCTGGGCATGGTGG - Intronic
1168297286 19:55383697-55383719 GAGGGGCGGGCGGGGCAGGGCGG - Intronic
1168339691 19:55615869-55615891 AACGGGCTGGCGGGGGAGGTGGG + Exonic
1168534106 19:57154848-57154870 AAGGTGGGGGCTGGGCATGGAGG - Intronic
925104873 2:1282738-1282760 GACGTGGGGGCGGGGGTGGGCGG - Intronic
926247224 2:11130383-11130405 AGCTGGCGGGAGGGGCAGGGCGG + Intergenic
926253486 2:11169725-11169747 AAGGTGGGAGAGGGGCAGGGTGG - Intronic
928489733 2:31769255-31769277 AATGTGAGGGCTGGGCATGGTGG + Intergenic
929777012 2:44936038-44936060 AAAGTAGGGGCGGGGAAGGGAGG - Intergenic
930430190 2:51265622-51265644 AAAGTGGGGGCTGGGCTGGGGGG + Intergenic
932238383 2:70139116-70139138 AACCTGCTGGCCGGGCGGGGTGG - Intergenic
933878265 2:86642200-86642222 AAAGTGGGGGAGGGGCAGGCAGG - Intronic
934163957 2:89277513-89277535 GTCGTGGGGGCGGGGGAGGGAGG + Intergenic
934203315 2:89905011-89905033 GTCGTGGGGGCGGGGGAGGGAGG - Intergenic
934563330 2:95324222-95324244 AACGTGAGGGCCGGGCGCGGTGG + Intronic
935820458 2:106887530-106887552 AGCCTGCGGGCGGGGCCGCGGGG + Intergenic
937590498 2:123607571-123607593 AAAGAGCTGGCGGGGCATGGTGG + Intergenic
937905286 2:127050020-127050042 ACCTTGTGGGCGGGGCAGGAGGG + Intronic
938034772 2:128027310-128027332 AATGGGCGGGCGGGGGAGGCAGG - Intronic
941508424 2:166376083-166376105 CTCCTGCGGGCGGCGCAGGGCGG + Intergenic
942584819 2:177464226-177464248 AACGTGCTGGCTGGGCACGGTGG - Intronic
943767392 2:191677898-191677920 AACGGGAGGGCGGGGGAGGCGGG + Intergenic
944780777 2:203014863-203014885 GACGAGCGGGCGGGACATGGGGG - Exonic
945257284 2:207813205-207813227 AACGGGGTGGCAGGGCAGGGCGG - Intergenic
946192663 2:218015739-218015761 AACGGGGGGTGGGGGCAGGGTGG + Intergenic
946460193 2:219862124-219862146 AACTTTCGGGCTGGGCAGGGTGG - Intergenic
946868713 2:224066564-224066586 TACTTGCGGGTGGAGCAGGGAGG - Intergenic
947373250 2:229469653-229469675 AAAGTGCTGGCCGGGCATGGTGG + Intronic
947491614 2:230600616-230600638 AAAATACGGGCGGGGCACGGTGG + Intergenic
948445894 2:238032642-238032664 AACATGCTGGCTGGGCATGGTGG + Intronic
948808435 2:240462920-240462942 TGCGTGGGGGCCGGGCAGGGTGG + Intronic
1168954781 20:1827321-1827343 AACCTGCGGGTGGGGAGGGGAGG + Intergenic
1169867717 20:10218752-10218774 GAAGTGGGGGCGGGGCACGGCGG - Intergenic
1171084891 20:22229001-22229023 AAAGTGAGGCAGGGGCAGGGAGG + Intergenic
1172094342 20:32453275-32453297 AAAGTGTGGGCCAGGCAGGGGGG + Intronic
1172117412 20:32581261-32581283 CAAGTGGGGGTGGGGCAGGGCGG - Intronic
1172137214 20:32695077-32695099 AACCTGGGGGCCGGGCACGGTGG - Intergenic
1173795726 20:45857982-45858004 TAAGGGCGGGCGGGGCGGGGCGG + Intronic
1174221616 20:48959886-48959908 AACGTTCTGGTGGGGCATGGTGG - Intronic
1175967323 20:62666098-62666120 AGCGGGGGGGCGGGGCGGGGCGG - Intronic
1176018851 20:62952648-62952670 GGCGGGCAGGCGGGGCAGGGCGG - Exonic
1176068958 20:63216176-63216198 AGCGTGCACGCGGGGCAGGCCGG + Exonic
1176242147 20:64080079-64080101 GACGCGCGGGCGGGGCGGGTGGG - Intergenic
1177186297 21:17801555-17801577 AACATACGGGCCGGGCACGGTGG - Intronic
1178867541 21:36342148-36342170 AACCTGCAGGTGGGGCAGTGCGG + Intronic
1179584742 21:42367423-42367445 AAGGTGTGGGAGGGGGAGGGAGG - Intergenic
1179658654 21:42861022-42861044 AACGGGCAGGCCGGGCACGGTGG + Intronic
1179882661 21:44300023-44300045 AAGGCGCGCGCGGGGCGGGGCGG + Intergenic
1180162264 21:46003375-46003397 AACGTGACTGCGGGGCGGGGTGG - Exonic
1182291612 22:29284263-29284285 AACTTGCAGGCTGGGCATGGTGG - Intronic
1183216294 22:36482155-36482177 AAGGCGGGGGCGGGGCGGGGCGG + Intergenic
1183437470 22:37804261-37804283 AATGTGGGGGCGGGGGAGGGCGG - Intergenic
1183571903 22:38659573-38659595 AATGTGCTGGCCGGGCACGGTGG + Intronic
1183586187 22:38754613-38754635 ACCGTACGGGCGGGGCAGGGAGG - Intronic
1183702152 22:39457053-39457075 CACGCGCGGGCGGCGCGGGGCGG + Intergenic
1184200127 22:42962765-42962787 AAGGTGTGGGCGGGGGGGGGGGG + Intronic
1184385874 22:44174240-44174262 AGGGTGCAGGTGGGGCAGGGGGG + Intronic
1185055329 22:48576047-48576069 AACGGCCGGGCGGCGCGGGGGGG - Intronic
1185223593 22:49640996-49641018 AAGATACGGGCCGGGCAGGGAGG - Intronic
1185251466 22:49803932-49803954 TGTGTGCGGGCAGGGCAGGGCGG + Intronic
949466983 3:4354140-4354162 AAGATGGGGGCTGGGCAGGGTGG - Intronic
949490867 3:4587556-4587578 GAAGTGTGGGCCGGGCAGGGTGG - Intronic
949552820 3:5125436-5125458 ATGGTGGGGGCGGGGCAGGGGGG - Intronic
952030147 3:29131872-29131894 AACATGCGGGCCGGGCGCGGTGG - Intergenic
952344151 3:32468434-32468456 AACGTGCAGGCCGGGCGCGGTGG - Intronic
952430440 3:33218629-33218651 AGCGTGGGGTCCGGGCAGGGAGG - Intronic
952868236 3:37872858-37872880 AAAGTGGGGGCTGGGCACGGTGG - Intronic
953388010 3:42517684-42517706 TAGGTGCGGGCTGGGCACGGTGG + Intronic
953930823 3:47004897-47004919 AGGGTGTGGGCAGGGCAGGGTGG + Intronic
954433097 3:50481706-50481728 AAAGTGCAGGCTGGGCATGGTGG + Intronic
954773109 3:52991629-52991651 AACGTGCAGGCTGGGCGAGGTGG - Intronic
954834128 3:53450186-53450208 AAATTGGGGGTGGGGCAGGGAGG - Intergenic
954838698 3:53493855-53493877 CACGTGGGGGCGGGGTGGGGTGG + Intergenic
955484627 3:59423318-59423340 CACGTGTGGGCCGGGCACGGTGG - Intergenic
955930472 3:64051507-64051529 TACTGGGGGGCGGGGCAGGGGGG - Intergenic
957661506 3:83161044-83161066 AACATTCGGGCTGGGCACGGTGG - Intergenic
960781270 3:121320984-121321006 AAAGTGTGGGCCGGGCACGGTGG - Intronic
961538383 3:127583954-127583976 CACGTGTGGGCTGGGCATGGTGG - Intronic
962351835 3:134661988-134662010 AAGGTGCCGGCTGGGCATGGTGG + Intronic
965387999 3:168069118-168069140 AAAGTGCAGGCCGGGCATGGTGG - Intronic
966406429 3:179603247-179603269 AACATGTGGGCTGGGCACGGTGG + Intronic
967840784 3:194003213-194003235 AGCCCGCGGGCGGGGCAGGAAGG + Intergenic
968564485 4:1303868-1303890 ACAGTGCCGGCAGGGCAGGGGGG + Intronic
968758014 4:2426879-2426901 AAAGTGGGGGTGGGGCATGGGGG - Intronic
968905225 4:3447736-3447758 AAGCTGGGGGCAGGGCAGGGAGG + Intronic
973867398 4:55127159-55127181 AAAGTGAAGGCTGGGCAGGGTGG - Intergenic
974067103 4:57088739-57088761 AACTTGCTGGCTGGGCACGGTGG + Intronic
975800384 4:78055395-78055417 AAAGGTCGGGCGGGGCGGGGGGG - Intergenic
976793426 4:88905998-88906020 AACATGCTGGCCGGGCATGGTGG + Intronic
980009329 4:127578786-127578808 AACGGGGGGGCGGGGGGGGGGGG + Intergenic
981690683 4:147505627-147505649 AAACTGCCGGCGGGGCAGGGTGG - Intronic
981719770 4:147789557-147789579 AACATGTGGGCCGGGCATGGTGG - Intronic
982289305 4:153763942-153763964 TACATGAGGGCAGGGCAGGGAGG + Intergenic
982523872 4:156453296-156453318 AACATGCGGGCTGGGCGCGGTGG - Intergenic
983936586 4:173506976-173506998 AACCTGCGGGTGAGGGAGGGAGG - Intergenic
984907469 4:184642320-184642342 TCCGTGCGGGCCGGGCACGGTGG - Intronic
985556594 5:561623-561645 ACCAGGCAGGCGGGGCAGGGTGG + Intergenic
987301373 5:16600583-16600605 CCTGTGGGGGCGGGGCAGGGAGG - Intronic
992189305 5:74275460-74275482 AAAGTGTGGGTGGGGGAGGGGGG - Intergenic
994286211 5:97971467-97971489 AACTTGTGGGCTGGGCATGGTGG - Intergenic
995506490 5:112866007-112866029 AACATGCAGGCTGGGCATGGTGG - Intronic
996251955 5:121346588-121346610 AAAGTGCTGGCCGGGCATGGTGG + Intergenic
997498088 5:134347580-134347602 AAAGTGCTGGCTGGGCACGGTGG + Intronic
997584075 5:135034398-135034420 AGGGCGCGGGCGAGGCAGGGAGG - Intronic
997749420 5:136330152-136330174 CATGTGGGGGCGGGGCAGGTGGG - Intronic
998471383 5:142386524-142386546 CACGTGGGGTGGGGGCAGGGGGG + Intergenic
998570583 5:143253338-143253360 AACAAGCAGGCGGGGCACGGTGG - Intergenic
999462883 5:151772044-151772066 GGGGTGTGGGCGGGGCAGGGAGG + Intronic
1000968758 5:167691215-167691237 AAGGTTGGGGTGGGGCAGGGAGG - Intronic
1001446001 5:171783952-171783974 GACGTTCGGGCAGGGCATGGTGG + Intergenic
1001504722 5:172269200-172269222 AAAGTTTGGGCGGGGCGGGGTGG + Intronic
1001882366 5:175255433-175255455 AGCTTTCGGGCCGGGCAGGGTGG + Intergenic
1002119939 5:176995259-176995281 AACTTGTGGGCTGGGCATGGTGG + Intronic
1002129835 5:177073812-177073834 ATCGGGCGGGCGGGGGAGGGGGG + Intronic
1002180033 5:177426622-177426644 AAACAGAGGGCGGGGCAGGGCGG + Intronic
1002598607 5:180340491-180340513 AACCTGCAGGCCAGGCAGGGTGG - Intronic
1002662628 5:180802365-180802387 TCCGTGCGTGCGGGGCAGGGAGG - Intronic
1002841842 6:913127-913149 GAGGTGGGGGCGGGGGAGGGGGG - Intergenic
1002910656 6:1488721-1488743 AAAGTGTGGGCTGGGCATGGTGG + Intergenic
1004919350 6:20361540-20361562 AAGATGCGGGCTGGGCATGGTGG + Intergenic
1005602347 6:27440714-27440736 AAGGTGCAGGCCGGGCACGGTGG + Intergenic
1005674577 6:28140910-28140932 AACGGGGTGGCGGGGCGGGGCGG - Intergenic
1006273258 6:32980769-32980791 AAGGGGCAGGTGGGGCAGGGTGG - Exonic
1006366900 6:33621350-33621372 TACGCGCGGGCCGGGCGGGGCGG + Exonic
1006534799 6:34690171-34690193 AAAATGCGGGCCGGGCATGGTGG + Intronic
1007277806 6:40688604-40688626 AAGGAGGGGGCGGGGGAGGGAGG - Intergenic
1007423910 6:41735051-41735073 ACCGGGCGGGAGGGGCCGGGCGG - Intronic
1007521712 6:42455117-42455139 AAGGTGGGGGGGGGGCGGGGCGG - Intergenic
1010134912 6:72540408-72540430 GGGGTGGGGGCGGGGCAGGGAGG - Intergenic
1010168201 6:72941634-72941656 GAGGTGCGGGTGGGGAAGGGAGG - Intronic
1010752674 6:79631970-79631992 CACTTGCTGGCGGGGAAGGGAGG - Intronic
1011463575 6:87631777-87631799 AATTTTCGGGCCGGGCAGGGTGG - Intronic
1011642220 6:89426224-89426246 AACATGTAGGCTGGGCAGGGTGG - Intergenic
1012046475 6:94281674-94281696 GACCTGGGGGTGGGGCAGGGTGG + Intergenic
1013464593 6:110406728-110406750 GAAGTGGGGGCGGGGCAGGGTGG - Intronic
1014223752 6:118824594-118824616 AGAGTGCAGGCGGGGCACGGTGG - Intronic
1014322597 6:119949655-119949677 ATCGTGGGGTCGGGGGAGGGGGG - Intergenic
1015617464 6:135092450-135092472 AAAGTGTGGGCTGGGCATGGTGG - Intronic
1016461377 6:144283451-144283473 AACCTGGGGGCTGGGCACGGTGG + Intergenic
1019536306 7:1531281-1531303 CACGTGCGGGCGGTGCGGGGAGG + Intronic
1019606533 7:1912898-1912920 GACGTGGGGGCGGGGCTGTGTGG + Intronic
1019924076 7:4180871-4180893 AACGTGCAGGTGGGGCCTGGCGG - Intronic
1019986788 7:4662734-4662756 AATGTGAGGGCCGGGCATGGTGG - Intergenic
1020092940 7:5351470-5351492 AACGTGAGTGCGGGGGTGGGGGG + Intronic
1020109349 7:5439572-5439594 CAGGCGGGGGCGGGGCAGGGGGG - Intronic
1020460419 7:8423981-8424003 AACGTAAGGGCCGGGCATGGTGG + Intergenic
1021994417 7:26166121-26166143 AGCGAGCGGGTGGGGCGGGGGGG + Intronic
1023552726 7:41387502-41387524 CACATGAGGGCTGGGCAGGGAGG - Intergenic
1025218129 7:57077435-57077457 AAAGTGGGGGCTGGGCATGGTGG + Intergenic
1025615555 7:63113820-63113842 GACGTGCGGGCAGGACCGGGTGG + Intergenic
1025629042 7:63251052-63251074 AAAGTGGGGGCTGGGCATGGTGG + Intergenic
1025653216 7:63493018-63493040 AAAGTGGGGGCTGGGCATGGTGG - Intergenic
1025850505 7:65239785-65239807 AGCGCGAGGGCGGGGCGGGGCGG + Intergenic
1025982173 7:66415528-66415550 AAAATGTGGGCGGGGCACGGTGG - Intronic
1025994315 7:66518559-66518581 ATGGTGCGGGCGGGCAAGGGAGG + Intergenic
1026000579 7:66557148-66557170 AACGTCAGGGCAGGGCAGAGGGG - Intergenic
1026854448 7:73743747-73743769 CAGGTGCGGGTGAGGCAGGGAGG - Intergenic
1026975318 7:74494372-74494394 ACCGTGCTGGAGGGGCCGGGGGG - Intronic
1027165158 7:75828990-75829012 AGCGTGTGGGCTGGGCACGGTGG + Intergenic
1027165981 7:75834745-75834767 AGCGTGTGGGCTGGGCACGGTGG - Intergenic
1027222914 7:76225465-76225487 AAGGGGCGGGGGGGGCGGGGAGG - Intronic
1029560580 7:101300205-101300227 AAAGCTCAGGCGGGGCAGGGCGG - Intergenic
1029561991 7:101308901-101308923 AAAGCTCAGGCGGGGCAGGGCGG - Intergenic
1030097608 7:105914791-105914813 ATTGTGGGGGCGGGGCGGGGGGG + Intronic
1030308923 7:108048976-108048998 AAAGTGCAGGCTGGGCACGGTGG - Intronic
1032037605 7:128531615-128531637 AAAGGGCGGGCGGGGGAGGGGGG - Intergenic
1032148945 7:129411050-129411072 AAGGTCCAGGCTGGGCAGGGTGG - Intronic
1033050662 7:138001575-138001597 ACCCGGCGGGCGGGGCAGGAGGG - Intronic
1033920158 7:146381083-146381105 AACGTGCAGGCCGGGCGCGGTGG - Intronic
1035714619 8:1744431-1744453 AACGGGCTGGCGTGGCCGGGAGG + Intergenic
1035828021 8:2665182-2665204 CACCTGGGGGCGGGGGAGGGGGG + Intergenic
1037725940 8:21482737-21482759 AACGTGGGGGCAGGGGATGGAGG - Intergenic
1037892007 8:22628521-22628543 AAGGTGGGGGCGTGGCAGAGGGG - Intronic
1038204543 8:25453366-25453388 AAGGTGAGGGCCGGGCACGGTGG + Intronic
1040570633 8:48606051-48606073 CACCTGAGGGCAGGGCAGGGGGG - Intergenic
1042301268 8:67285097-67285119 AAGGGGGGGGTGGGGCAGGGTGG + Intronic
1044591334 8:93916902-93916924 AACGTGCGGGCGGGGCAGGGTGG + Intronic
1045307206 8:100968489-100968511 AACGTGTCGGCGGGGCACGGTGG - Intergenic
1046547487 8:115669275-115669297 AACGTGCGGGCTGGAAAAGGAGG + Intronic
1047963015 8:130024530-130024552 AGCTTGGGGGCGGGGCGGGGTGG - Intergenic
1049411451 8:142475637-142475659 TGAGTGCGGGCGGGGCGGGGCGG + Intronic
1049643252 8:143725003-143725025 AAGGGGTGGGTGGGGCAGGGGGG - Exonic
1049666639 8:143846969-143846991 AACTTGCTGGCGGGGCGCGGTGG + Intergenic
1050876298 9:10641039-10641061 AGCGTGGGGTCGGGGGAGGGGGG - Intergenic
1052728644 9:32260540-32260562 CAGGTGGGGGCGGGGCGGGGGGG - Intergenic
1056691444 9:88811903-88811925 AACGTGGGGTGGGGGCAGGCGGG - Intergenic
1056991995 9:91421442-91421464 AATGTGGGGAGGGGGCAGGGAGG + Intronic
1057594807 9:96406711-96406733 ACCGTGGGGGCCGGGCACGGTGG + Intronic
1058760631 9:108128119-108128141 AAGGTGAGGGCCGGGCACGGTGG + Intergenic
1058815362 9:108678043-108678065 CACTTGCGGGCCGGGCATGGTGG + Intergenic
1059304956 9:113346895-113346917 AAGGTGGGGGGGGGGGAGGGGGG - Intergenic
1059782771 9:117547189-117547211 CACGTGTGGGTGGGGCGGGGCGG + Intergenic
1059883243 9:118715577-118715599 AAAGAGAGGGGGGGGCAGGGAGG - Intergenic
1060280753 9:122214067-122214089 AACCTGCGGGGCGGGGAGGGCGG + Exonic
1060775388 9:126369938-126369960 AACATGCTGGCTGGGCATGGTGG - Intronic
1060811724 9:126614254-126614276 GTCGTGCGGGCGGGCCGGGGCGG - Intergenic
1060849222 9:126860776-126860798 TAGGCGCGGGCGGGGCAGGCGGG + Intronic
1061026708 9:128054497-128054519 AACGTGGGAGTGGGGGAGGGAGG + Intergenic
1061657968 9:132107298-132107320 AAATTGCGGGCTGGGCATGGTGG + Intergenic
1061991110 9:134159248-134159270 ACAGTGAGGGCGGAGCAGGGTGG + Exonic
1062460160 9:136659600-136659622 AGCGTGCTGGCTGGGCAGAGAGG - Exonic
1062546250 9:137064933-137064955 GACGTCAGGGCAGGGCAGGGGGG + Exonic
1185457615 X:318681-318703 AGCGCGCGCGCGGGGCAGGACGG + Exonic
1187377300 X:18766759-18766781 AACGTTCTGGCTGGGCACGGTGG + Intronic
1187477577 X:19625837-19625859 AACTTGGGGGCTGGGCAAGGTGG - Intronic
1188987909 X:36784512-36784534 AAGGTACGGGCTGGGCACGGTGG + Intergenic
1189398406 X:40643795-40643817 AATGTCCAGGCGGGGCACGGTGG - Intronic
1190289271 X:48981531-48981553 AGCGTACAGGAGGGGCAGGGAGG - Intronic
1191053886 X:56222694-56222716 ACCGTGGGGGCAGGGCATGGCGG + Intergenic
1193130362 X:77913392-77913414 AACATGGGGCCGGGGCAAGGGGG + Intronic
1193601230 X:83509948-83509970 AACGTGGGGGCGGGGTGGGGCGG + Intergenic
1194248432 X:91542951-91542973 AATGTGCAGGCAGGGCAAGGTGG + Intergenic
1195079657 X:101358848-101358870 AAGGTGCAGGCCGGGCATGGTGG + Intronic
1195316853 X:103687520-103687542 ATGGTGGGGGCGGTGCAGGGAGG + Intronic
1197764503 X:130051171-130051193 ATCGTGGGGGCAGGGTAGGGAGG - Intronic
1197804568 X:130386493-130386515 AACGTGGGGGCGGTTGAGGGGGG + Intergenic
1198503923 X:137282083-137282105 AACCTGCGGGCAGTGTAGGGGGG + Intergenic
1200107839 X:153724584-153724606 AGCACGCGGGCGGGGCGGGGCGG + Intronic
1200130360 X:153839874-153839896 AAGATGTGGGCGGGGCATGGTGG - Intergenic
1200567443 Y:4784471-4784493 AATGTGCAGGCAGGGCAAGGTGG + Intergenic
1201521672 Y:14882367-14882389 GTCGTGGGGTCGGGGCAGGGTGG - Intergenic