ID: 1044591335

View in Genome Browser
Species Human (GRCh38)
Location 8:93916905-93916927
Sequence GTGCGGGCGGGGCAGGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2914
Summary {0: 1, 1: 0, 2: 8, 3: 168, 4: 2737}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044591322_1044591335 11 Left 1044591322 8:93916871-93916893 CCAATCGGCAGGCGGGAAGCACT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591316_1044591335 30 Left 1044591316 8:93916852-93916874 CCCACTCGTCACTGCGCAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737
1044591317_1044591335 29 Left 1044591317 8:93916853-93916875 CCACTCGTCACTGCGCAGCCAAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1044591335 8:93916905-93916927 GTGCGGGCGGGGCAGGGTGGCGG 0: 1
1: 0
2: 8
3: 168
4: 2737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044591335 Original CRISPR GTGCGGGCGGGGCAGGGTGG CGG Intronic
Too many off-targets to display for this crispr