ID: 1044598291

View in Genome Browser
Species Human (GRCh38)
Location 8:93979609-93979631
Sequence CATCTAAGCTCCAAGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044598284_1044598291 -5 Left 1044598284 8:93979591-93979613 CCTCTCCTGCCCAGCAGTCATCT No data
Right 1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG No data
1044598285_1044598291 -10 Left 1044598285 8:93979596-93979618 CCTGCCCAGCAGTCATCTAAGCT No data
Right 1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG No data
1044598283_1044598291 28 Left 1044598283 8:93979558-93979580 CCAATACTCAGGCAATCTCTGCA No data
Right 1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044598291 Original CRISPR CATCTAAGCTCCAAGGGGTT TGG Intergenic
No off target data available for this crispr