ID: 1044598965

View in Genome Browser
Species Human (GRCh38)
Location 8:93984763-93984785
Sequence TTGCTTGTAAAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044598958_1044598965 14 Left 1044598958 8:93984726-93984748 CCTGTCTTGTATTTCTTCCCAAG No data
Right 1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG No data
1044598961_1044598965 -3 Left 1044598961 8:93984743-93984765 CCCAAGCTGGAAGTAGGTTTTTG No data
Right 1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG No data
1044598962_1044598965 -4 Left 1044598962 8:93984744-93984766 CCAAGCTGGAAGTAGGTTTTTGC No data
Right 1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044598965 Original CRISPR TTGCTTGTAAAGCTGGAGCA GGG Intergenic
No off target data available for this crispr