ID: 1044605166

View in Genome Browser
Species Human (GRCh38)
Location 8:94041929-94041951
Sequence TCCTCCCCATTTACAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044605163_1044605166 8 Left 1044605163 8:94041898-94041920 CCAGTGAGTAGAACCAAGGGTCA No data
Right 1044605166 8:94041929-94041951 TCCTCCCCATTTACAGAAGATGG No data
1044605164_1044605166 -5 Left 1044605164 8:94041911-94041933 CCAAGGGTCAGAACCTCATCCTC No data
Right 1044605166 8:94041929-94041951 TCCTCCCCATTTACAGAAGATGG No data
1044605160_1044605166 16 Left 1044605160 8:94041890-94041912 CCTGAGGGCCAGTGAGTAGAACC No data
Right 1044605166 8:94041929-94041951 TCCTCCCCATTTACAGAAGATGG No data
1044605159_1044605166 25 Left 1044605159 8:94041881-94041903 CCAAAGCAACCTGAGGGCCAGTG No data
Right 1044605166 8:94041929-94041951 TCCTCCCCATTTACAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044605166 Original CRISPR TCCTCCCCATTTACAGAAGA TGG Intergenic
No off target data available for this crispr