ID: 1044605976

View in Genome Browser
Species Human (GRCh38)
Location 8:94047783-94047805
Sequence GGCCTAAATAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044605968_1044605976 15 Left 1044605968 8:94047745-94047767 CCTCCCCAGTGCAGGTAGTCATC No data
Right 1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG No data
1044605974_1044605976 -10 Left 1044605974 8:94047770-94047792 CCAAACTGTTGAGGGCCTAAATA No data
Right 1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG No data
1044605971_1044605976 10 Left 1044605971 8:94047750-94047772 CCAGTGCAGGTAGTCATCATCCA No data
Right 1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG No data
1044605969_1044605976 12 Left 1044605969 8:94047748-94047770 CCCCAGTGCAGGTAGTCATCATC No data
Right 1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG No data
1044605970_1044605976 11 Left 1044605970 8:94047749-94047771 CCCAGTGCAGGTAGTCATCATCC No data
Right 1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044605976 Original CRISPR GGCCTAAATAGAACAAAAGG TGG Intergenic
No off target data available for this crispr