ID: 1044608630

View in Genome Browser
Species Human (GRCh38)
Location 8:94070189-94070211
Sequence TCCTCTCTCTGTCCATGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044608630_1044608632 16 Left 1044608630 8:94070189-94070211 CCATCTCATGGACAGAGAGAGGA No data
Right 1044608632 8:94070228-94070250 AGAAACCCACTCCCAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044608630 Original CRISPR TCCTCTCTCTGTCCATGAGA TGG (reversed) Intergenic
No off target data available for this crispr