ID: 1044609531

View in Genome Browser
Species Human (GRCh38)
Location 8:94078438-94078460
Sequence TAGCCAGAGCTGCATCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044609527_1044609531 9 Left 1044609527 8:94078406-94078428 CCACAGTGTGATTGAGATGCCAA No data
Right 1044609531 8:94078438-94078460 TAGCCAGAGCTGCATCAACCTGG No data
1044609528_1044609531 -10 Left 1044609528 8:94078425-94078447 CCAAGCCATGACCTAGCCAGAGC No data
Right 1044609531 8:94078438-94078460 TAGCCAGAGCTGCATCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044609531 Original CRISPR TAGCCAGAGCTGCATCAACC TGG Intergenic
No off target data available for this crispr