ID: 1044611540

View in Genome Browser
Species Human (GRCh38)
Location 8:94096914-94096936
Sequence CCTCTCCCTGACATTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044611535_1044611540 5 Left 1044611535 8:94096886-94096908 CCCAGAGAGACTGAAATTCTGCA No data
Right 1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG No data
1044611536_1044611540 4 Left 1044611536 8:94096887-94096909 CCAGAGAGACTGAAATTCTGCAT No data
Right 1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG No data
1044611534_1044611540 29 Left 1044611534 8:94096862-94096884 CCTCAACAACAGCTGTATGCACT No data
Right 1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044611540 Original CRISPR CCTCTCCCTGACATTGCCAT GGG Intergenic
No off target data available for this crispr