ID: 1044614807

View in Genome Browser
Species Human (GRCh38)
Location 8:94129001-94129023
Sequence CCTGCTAGTAAGTTTATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044614803_1044614807 12 Left 1044614803 8:94128966-94128988 CCACTATGAAGAAGGAGTTGTTT 0: 1
1: 0
2: 1
3: 15
4: 220
Right 1044614807 8:94129001-94129023 CCTGCTAGTAAGTTTATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044614807 Original CRISPR CCTGCTAGTAAGTTTATAGG AGG Intronic
No off target data available for this crispr