ID: 1044614826

View in Genome Browser
Species Human (GRCh38)
Location 8:94129222-94129244
Sequence ATTTGCCCTCCCACCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044614826_1044614830 7 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG No data
1044614826_1044614831 25 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614831 8:94129270-94129292 AAGGGACCTATGTAAGTGAGTGG No data
1044614826_1044614828 -1 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614828 8:94129244-94129266 TAGAATAAGAAAAGGCACAGAGG No data
1044614826_1044614827 -9 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614827 8:94129236-94129258 AGGGCAAATAGAATAAGAAAAGG No data
1044614826_1044614829 6 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614829 8:94129251-94129273 AGAAAAGGCACAGAGGCAGAAGG No data
1044614826_1044614832 26 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614832 8:94129271-94129293 AGGGACCTATGTAAGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044614826 Original CRISPR ATTTGCCCTCCCACCTTGAA AGG (reversed) Intronic
902216696 1:14938701-14938723 CTTTGCTCTCCCACTTAGAAGGG + Intronic
902738149 1:18414768-18414790 AATTGCCCTTCCACCCTAAATGG - Intergenic
906962299 1:50426028-50426050 ATTTGCCCTCCCTCCATAACGGG - Intergenic
908394926 1:63716675-63716697 ATTTGCCATCCCAACCAGAAAGG + Intergenic
912242292 1:107923852-107923874 ATTTGCCCTTCCATCTTGTAAGG + Intronic
912623883 1:111192180-111192202 ATTTGTACTCCAACCATGAAGGG + Exonic
913984619 1:143553601-143553623 ATTTGCACTCCCTCCTTTATTGG - Intergenic
915640637 1:157221959-157221981 ATTTGCCCTCTCATGTTCAATGG - Intergenic
915650304 1:157305087-157305109 CTGTAACCTCCCACCTTGAAGGG - Intergenic
916351741 1:163857675-163857697 ATTTTCCTTTCCAACTTGAAAGG + Intergenic
916567915 1:165997633-165997655 ATCTGACCTCCCTCCTAGAAAGG - Intergenic
917452535 1:175158774-175158796 ATTTGCCCTCTCACCCTATATGG - Intronic
918313031 1:183300078-183300100 ATTTGCCCTTCCTCCTTGTGAGG + Intronic
919797861 1:201332138-201332160 ATTTCCCCTCCCGCCCTGACCGG - Exonic
921309679 1:213830575-213830597 ACTTGCCCCTCCACCTTCAACGG + Intergenic
921398397 1:214693371-214693393 CTTTTGCCTTCCACCTTGAATGG + Intergenic
923861190 1:237893673-237893695 ATTTGCCCTTTCACATTCAAAGG - Intergenic
1063615115 10:7593899-7593921 ACTTGCCTTCCCACCTCCAATGG + Intronic
1064800798 10:19069041-19069063 ATTTGCATTCCCATCTTTAAAGG - Intronic
1066566561 10:36727546-36727568 TTTTGCACACTCACCTTGAATGG + Intergenic
1067693249 10:48517962-48517984 CTCTGCCCTCCCACCTGCAATGG - Intronic
1069556401 10:69401343-69401365 ACTTGCCCTGCCACTTTGCATGG + Exonic
1072981688 10:100103444-100103466 ATTTGACCTCCCAGCTTCAAGGG + Intergenic
1073713475 10:106073386-106073408 ATAGGCACTCCCACCTTGACTGG + Intergenic
1074835135 10:117284553-117284575 ATGAGACCTCCCAACTTGAAAGG + Exonic
1075216539 10:120541302-120541324 ATCTTCCCTCACACCCTGAAAGG - Intronic
1075839472 10:125487478-125487500 CATTGCCCTCCCTCCCTGAAAGG + Intergenic
1076419464 10:130319786-130319808 ATTGGCCCAGCCACTTTGAAAGG - Intergenic
1078839560 11:15065748-15065770 ATTTGACCTCTCACCTGGATGGG - Intronic
1088551292 11:111014769-111014791 AATAGCCCTCCCACCTGGATTGG + Intergenic
1091702964 12:2676231-2676253 TTTTTCCCTCCCACGTGGAAAGG + Intronic
1093736517 12:22625727-22625749 ATTTCCCCTCACACCTAGGAGGG + Intronic
1093879423 12:24386950-24386972 ATATGCCCTGCCAACTTAAATGG - Intergenic
1094244806 12:28276641-28276663 ATTTGCCCCAAGACCTTGAAAGG - Intronic
1097318937 12:58204391-58204413 TTTTCCCCTCCTAACTTGAAGGG + Intergenic
1103355534 12:120317173-120317195 ATTTCCACCCCCACATTGAAGGG - Intergenic
1107001379 13:35549649-35549671 CTTTGCCCTTCCTGCTTGAATGG - Intronic
1109440400 13:62363852-62363874 ATTTACTCTCCCACCTTTCATGG - Intergenic
1112255617 13:97828005-97828027 ATTAACCCTCCCACCCTCAAAGG + Intergenic
1112502422 13:99953373-99953395 CTTTGCCCTCGCCCCTTAAAGGG + Intergenic
1113018088 13:105851009-105851031 ATTTTCACTGCCACCTTTAAGGG - Intergenic
1115273150 14:31577067-31577089 ATGTGCCTTCCCACATTCAAGGG + Intronic
1123989685 15:25674151-25674173 CTTTGCCCTCCAACCCTGCAGGG - Intergenic
1126690578 15:51286100-51286122 ATTTGCCCTCTCACCCGCAATGG + Intronic
1134432836 16:14227379-14227401 ATTTCCCCTCCCACCATGAGTGG + Intronic
1135595014 16:23735105-23735127 ACTTTCCCTAACACCTTGAATGG - Intergenic
1138954720 16:61957209-61957231 ATATGCACGCACACCTTGAAAGG + Intronic
1144136426 17:12299658-12299680 ATTTCCCCCCCCACCTTGTAAGG + Intergenic
1147161569 17:38572108-38572130 GGTTGCCCTCCCTCCTTGGAAGG - Intronic
1151702411 17:75750458-75750480 ATTTGCCCTCCTTCCTAGAATGG + Intronic
1155354654 18:24940567-24940589 TTTTTCACTCTCACCTTGAATGG - Intergenic
1161725606 19:5926747-5926769 TCTTGCCCTCCCTCCTTGGAGGG + Intronic
1164835792 19:31354338-31354360 AAATGCCCTCACACTTTGAAAGG - Intergenic
925753659 2:7111895-7111917 ATTTGGCCCCTAACCTTGAAAGG + Intergenic
927565724 2:24110994-24111016 ATAAACCCTCCCACTTTGAATGG + Intronic
932994474 2:76833323-76833345 ATTTGTCCTCCAACTTTGTATGG + Intronic
933182565 2:79243851-79243873 ATGTGCACTCCCACATGGAAAGG - Intronic
937428322 2:121817821-121817843 ATTTGCCCTCCCAACCCCAATGG - Intergenic
940722106 2:157293328-157293350 TTTTGCCCTTCCACCATGTAAGG - Intronic
943409446 2:187528372-187528394 ATTTTCCCTTCAAACTTGAAAGG + Intronic
1175182384 20:57157673-57157695 CTTTGTCCTTCCACCTTGCAAGG - Intergenic
1175309551 20:58002248-58002270 ATTTGCACTCCAACCATGAGTGG - Intergenic
1181340840 22:22178734-22178756 ATTTGCTTTCCCTCCTTGGAAGG - Intergenic
1184845091 22:47077953-47077975 ATTTGCGCTCCTTCCTGGAATGG + Intronic
950227455 3:11247542-11247564 ATATGCCTTCCCACCTAGTAAGG - Intronic
952079058 3:29735174-29735196 ATTTGCTTAGCCACCTTGAAAGG + Intronic
952389850 3:32870662-32870684 ATTTGCAATCCCCCCATGAATGG - Intronic
952509818 3:34041828-34041850 ATTTGCCCTTCCACCATGTGAGG + Intergenic
953711184 3:45272608-45272630 ATTTGCCCTCCCACCTAGGTGGG - Intergenic
954760300 3:52869071-52869093 ATTTCCCCTGCCATCTTGAGGGG + Intronic
957539820 3:81552901-81552923 ATGTTCCCTCCCATATTGAAGGG - Intronic
964787479 3:160414144-160414166 ATTTTCCCTCCAACTTAGAAAGG + Intronic
966067759 3:175836818-175836840 GATTGCCCTCCCAACGTGAATGG + Intergenic
968064562 3:195751324-195751346 AGACGCCCTCCCACCTTGATGGG + Intronic
971412645 4:26391358-26391380 AATTGCCTTCGCACCTTGACTGG - Intronic
990291640 5:54358001-54358023 CTTTGCCCACCCAACTTCAAGGG + Intergenic
995948907 5:117685754-117685776 ATTTCCTATTCCACCTTGAAGGG - Intergenic
1001451883 5:171832696-171832718 ATTTGTACTGCCACCTTGTAGGG - Intergenic
1003455328 6:6276534-6276556 ATTTGCTCTATCACCTTTAAGGG + Intronic
1005325371 6:24694867-24694889 ATTTTTCCCCCCAACTTGAAAGG - Intronic
1009370564 6:62895300-62895322 TACTGCCCTCCCACCTCGAAAGG + Intergenic
1009700113 6:67165974-67165996 ATAGGCTCTCCCACCATGAATGG - Intergenic
1014656840 6:124117074-124117096 ATTTGCCTTCCCACCAAGAAAGG + Intronic
1015321531 6:131880878-131880900 ATTTGCCCTCACTCCTTTCAAGG - Intronic
1018280297 6:162178515-162178537 AATTGACCTCCAACCTTTAAGGG - Intronic
1021145206 7:17078995-17079017 AATTGTCCTCCCTCCTTTAATGG + Intergenic
1022649983 7:32265914-32265936 ACCTGACCTCCCACCTTGTAGGG - Intronic
1022664924 7:32401780-32401802 AGCTTCCTTCCCACCTTGAAGGG + Intergenic
1023688700 7:42763812-42763834 AATTGCCCTCCCATCTTGGAAGG + Intergenic
1026562218 7:71459682-71459704 ATTTTCCCCCCCACAATGAATGG - Intronic
1028903901 7:96131989-96132011 ATTTGTACTCACACATTGAAAGG + Intronic
1029243292 7:99179974-99179996 AGTTCCCCACCCACATTGAATGG + Intronic
1029932292 7:104385047-104385069 CTTTACTCTCCCACCTGGAATGG + Intronic
1031743815 7:125468535-125468557 CCTTGCCCTCCCACCCTGCAAGG + Intergenic
1032079520 7:128851738-128851760 ATGACCCCTCACACCTTGAAGGG - Intronic
1032701485 7:134383746-134383768 CCTTGTCCTCCCACCATGAATGG + Intergenic
1033370122 7:140699600-140699622 ATTAGCCTTCCCACCTTGGGTGG + Intronic
1034836195 7:154353402-154353424 AAATGCCCTCCCACTTTGCAGGG - Intronic
1037319698 8:17631219-17631241 ATTTCCCCTCCTCCCTTGCAAGG - Intronic
1037821214 8:22135572-22135594 ACTTGCCCTCCCTCCTAGGATGG - Intergenic
1038883135 8:31636745-31636767 ATTTACCCACCCACATTGGAAGG - Intergenic
1041009464 8:53527422-53527444 AATTCCCCTCACCCCTTGAAAGG - Intergenic
1044614826 8:94129222-94129244 ATTTGCCCTCCCACCTTGAAAGG - Intronic
1046396743 8:113650275-113650297 ATTTCCCCTTCCACCTTGTGAGG + Intergenic
1046634479 8:116658542-116658564 ATCTCCCCTCCCTCATTGAAGGG - Intronic
1047723695 8:127666446-127666468 ATTTGCCCACCCTCACTGAAAGG + Intergenic
1051864023 9:21658558-21658580 ATTTGCCCTTCCATTTTGGATGG + Intergenic
1055869284 9:80855044-80855066 GCATGCCCTCCCACCTGGAAAGG - Intergenic
1057038714 9:91832172-91832194 TTTTTCCCTCACACCTGGAATGG - Intronic
1059658518 9:116378424-116378446 ATTTGGCCATCCACCTGGAAGGG - Intronic
1187788163 X:22917188-22917210 ATTTGCCCTCTAAACTTCAAAGG + Intergenic
1187790596 X:22945975-22945997 ATTTCTCCTCCCATCTAGAACGG + Intergenic
1188584563 X:31757608-31757630 CCTTGCCCTCCCACCATGTAAGG - Intronic
1189600507 X:42619783-42619805 ATTTTCCCACCCTCCTAGAATGG - Intergenic