ID: 1044614830 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:94129252-94129274 |
| Sequence | GAAAAGGCACAGAGGCAGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044614826_1044614830 | 7 | Left | 1044614826 | 8:94129222-94129244 | CCTTTCAAGGTGGGAGGGCAAAT | 0: 1 1: 0 2: 0 3: 8 4: 105 |
||
| Right | 1044614830 | 8:94129252-94129274 | GAAAAGGCACAGAGGCAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044614830 | Original CRISPR | GAAAAGGCACAGAGGCAGAA GGG | Intronic | ||
| No off target data available for this crispr | |||||