ID: 1044614830

View in Genome Browser
Species Human (GRCh38)
Location 8:94129252-94129274
Sequence GAAAAGGCACAGAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044614826_1044614830 7 Left 1044614826 8:94129222-94129244 CCTTTCAAGGTGGGAGGGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044614830 Original CRISPR GAAAAGGCACAGAGGCAGAA GGG Intronic
No off target data available for this crispr