ID: 1044615810

View in Genome Browser
Species Human (GRCh38)
Location 8:94139601-94139623
Sequence AGGAAGAACCATAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044615804_1044615810 12 Left 1044615804 8:94139566-94139588 CCAGAGAAAAAAGAATACAAACA 0: 1
1: 0
2: 7
3: 128
4: 1447
Right 1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG No data
1044615803_1044615810 13 Left 1044615803 8:94139565-94139587 CCCAGAGAAAAAAGAATACAAAC 0: 1
1: 0
2: 3
3: 118
4: 1305
Right 1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044615810 Original CRISPR AGGAAGAACCATAGTGGGCA GGG Intronic
No off target data available for this crispr