ID: 1044618180

View in Genome Browser
Species Human (GRCh38)
Location 8:94163504-94163526
Sequence GAGCATCCCCCAAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044618180_1044618188 4 Left 1044618180 8:94163504-94163526 CCTTGCTCCTTTGGGGGATGCTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1044618188 8:94163531-94163553 CCCTGGCTCCTTCAGGTTTTAGG No data
1044618180_1044618190 5 Left 1044618180 8:94163504-94163526 CCTTGCTCCTTTGGGGGATGCTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1044618190 8:94163532-94163554 CCTGGCTCCTTCAGGTTTTAGGG No data
1044618180_1044618183 -3 Left 1044618180 8:94163504-94163526 CCTTGCTCCTTTGGGGGATGCTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1044618183 8:94163524-94163546 CTCCCCTCCCTGGCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044618180 Original CRISPR GAGCATCCCCCAAAGGAGCA AGG (reversed) Intronic
901234492 1:7660705-7660727 GAGCTTCAGCCAAAGGAGGAAGG + Intronic
901758776 1:11457294-11457316 GGCCATCCCCCAAAGGTGCTGGG - Intergenic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
905625648 1:39489334-39489356 GAGCAGCCCCCACAGCAACAGGG - Intergenic
906479215 1:46189298-46189320 GAGCCACCCCCAAAGGAGGAGGG - Exonic
907776506 1:57521315-57521337 GTGCATCCCTCATAGCAGCATGG - Intronic
909712862 1:78672640-78672662 GAGCTTCTCCCACAGGAGCTTGG - Intergenic
912491918 1:110067129-110067151 GAGCAGCCTCCTGAGGAGCAAGG + Intronic
913259577 1:116986168-116986190 CAGCGTCCACCCAAGGAGCATGG + Intronic
917143567 1:171863251-171863273 GGGCATCCCACAGAGGAGTAGGG + Intronic
918742709 1:188155520-188155542 GAGCATCTGCCAAAGGACAAAGG + Intergenic
919845673 1:201640619-201640641 GAGCTTCCTTCAAAGGAGCAAGG + Intronic
920857706 1:209676185-209676207 AAGCATCCACCAAAGGAGTTTGG + Exonic
921323629 1:213968587-213968609 GTGCATTCCCCAAAAGAACAAGG - Intergenic
1062834373 10:626374-626396 CAGCATCCCCCAAAGGCACCTGG + Intronic
1063093662 10:2890367-2890389 GAGGGTCCCCCACAGCAGCACGG + Intergenic
1063114765 10:3066329-3066351 GGGCAGCCCCCATAGAAGCACGG - Intronic
1063655856 10:7987809-7987831 TAGCTTCCCCCAAAGAAGAAAGG - Intronic
1068524205 10:58109019-58109041 CAGCCTCCCCCGAAGTAGCAGGG + Intergenic
1069709782 10:70480791-70480813 GGGCATCCCCCACAGGTGCCTGG - Intronic
1069849587 10:71396600-71396622 ACGAATCCCCCAAAGGGGCAGGG - Intergenic
1075074950 10:119344560-119344582 AACCATCCCCAAAAAGAGCAGGG - Intronic
1075911693 10:126130670-126130692 CAGCCTCCCACAAAGGTGCAGGG - Intronic
1077616204 11:3675860-3675882 CAGAATCCCCCAAAGAACCAGGG - Exonic
1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG + Intergenic
1081887125 11:46507532-46507554 GAGGATGCGCTAAAGGAGCAGGG - Intronic
1083436597 11:62647434-62647456 CAGCAGCCCCCGAAGCAGCACGG + Exonic
1083934850 11:65864882-65864904 GTGCATCCCCAAAAGAAGCAAGG + Intronic
1084532333 11:69735004-69735026 GAACATCCCCAACAGGAGAATGG + Intergenic
1087391317 11:97538105-97538127 AAGCAACACCCAAAGGATCATGG + Intergenic
1087409293 11:97770529-97770551 GAGCAGCCCCCAAAAAAGGAAGG - Intergenic
1092769173 12:11881384-11881406 GAGCAGCCCCAAAAGGACTAAGG - Intronic
1101043873 12:100784662-100784684 GAGGATCCTCCAAAGGAAAAAGG + Intronic
1101959779 12:109240037-109240059 GACAATACCCCAAAGCAGCATGG - Intronic
1102602888 12:114046134-114046156 GAGACTCCCCCAAAAAAGCAAGG - Intergenic
1102804384 12:115766703-115766725 ATGCATTCTCCAAAGGAGCAGGG - Intergenic
1103261592 12:119593647-119593669 GAGCCTCCCCACAAGGAGGAAGG - Exonic
1103958986 12:124595671-124595693 AAGCATCCCCCAAGGAACCAAGG + Intergenic
1105224927 13:18423495-18423517 GACCCTCCCCCAGAGGAGAATGG - Intergenic
1105418436 13:20232465-20232487 GACCGTCCCCCTGAGGAGCAAGG + Intergenic
1106232610 13:27832951-27832973 GAGCATTTTCCAAAGGAGAAGGG - Intergenic
1112095135 13:96124369-96124391 GCCCATCCACCAAAGAAGCATGG - Intronic
1114009033 14:18347862-18347884 GACCCTCCCCCAGAGGAGAATGG - Intergenic
1116019473 14:39442626-39442648 GAGCGACACCCAAAGGAGCATGG + Intergenic
1116160208 14:41258261-41258283 TTGCATCCCCCAATGGGGCATGG + Intergenic
1117597431 14:57337653-57337675 GAGCATCCCACAGAGTAGCCTGG - Intergenic
1119657710 14:76429205-76429227 CAGCCTCCCCCAAAGCAGCCTGG + Intronic
1125217022 15:37286794-37286816 GAGAATCCCCCAAATAACCAGGG + Intergenic
1127637437 15:60884822-60884844 AAACAGCCCCCAAAAGAGCACGG + Intronic
1127652824 15:61025417-61025439 GAACCTCCTCCAAAGCAGCAGGG + Intronic
1130286880 15:82563162-82563184 GAGCAAAACCAAAAGGAGCAAGG + Intronic
1131832264 15:96361364-96361386 GAACCTCCCCCAGAGGAGAAAGG - Intergenic
1132760411 16:1506146-1506168 GAGGATCCCACAAAGCAGCGTGG - Intronic
1133180899 16:4053876-4053898 GGGCATTACCCAGAGGAGCAAGG + Intronic
1133453918 16:5926029-5926051 GAACATCACCCAAGTGAGCAAGG - Intergenic
1137580531 16:49631059-49631081 GTGCAACCCCCAGAGAAGCAGGG + Intronic
1139010024 16:62620474-62620496 GAACATTCCCCAAAGGGGGATGG + Intergenic
1141003057 16:80325975-80325997 GTGAATCCCCCAAAGGTGAAAGG - Intergenic
1141208713 16:81956597-81956619 AAGCATGCCCAAAGGGAGCATGG - Intronic
1141961775 16:87413716-87413738 GAGGGTCCCCCAAAGCAGGAAGG + Intronic
1142186186 16:88695749-88695771 GAGACACCCCCAAGGGAGCAGGG - Intergenic
1142365318 16:89646975-89646997 GAGCCTCCCCACAAGGAGCCAGG + Intronic
1143541338 17:7571261-7571283 GAACATCCCCAAAGGGAGCCAGG - Intronic
1144004067 17:11084048-11084070 GAGCTTCCCCCACTGGATCATGG - Intergenic
1147033373 17:37660228-37660250 CAGCATCCCCCAAGTTAGCAAGG + Intergenic
1148864820 17:50623017-50623039 GAGGACCCTCCCAAGGAGCAGGG - Intronic
1148898315 17:50854034-50854056 GAGCATCTGCCAAAGGAGAAGGG - Intergenic
1148940663 17:51208095-51208117 GAGCATCCACCAAAGTAGGAGGG - Intronic
1151385142 17:73750663-73750685 CAGCATCCCCCAGAGGGCCAAGG - Intergenic
1152257195 17:79247003-79247025 GCCCATCTCCCAAAGGAGAAAGG - Intronic
1152557688 17:81062550-81062572 GAGCAGCCCACGAGGGAGCAGGG - Intronic
1154528436 18:15316027-15316049 GACCCTCCCCCAGAGGAGAATGG + Intergenic
1157011596 18:43655645-43655667 AAGCATCCAGCATAGGAGCATGG + Intergenic
1158461918 18:57653998-57654020 GAGCAGCCCCATGAGGAGCACGG + Exonic
1161842886 19:6693502-6693524 GAGGAACCCCCAAAAGAGCCGGG + Intronic
1165974261 19:39660688-39660710 GATCATCCCCAAAAGGGGCCAGG + Intergenic
925077227 2:1027009-1027031 CAGCATCACACAAGGGAGCAAGG - Intronic
925405389 2:3602689-3602711 GAGCAACCCCCAAAGCTGCTGGG + Intronic
928223199 2:29422404-29422426 GAGGCTCCCCCATAGGATCAGGG - Intronic
928259497 2:29754164-29754186 CAGCATCCTGCAAAGGTGCATGG - Intronic
930260926 2:49145046-49145068 CAGCTTCCCCCAAAGCAGCTGGG - Intronic
931078956 2:58747464-58747486 GAGCACCCCCTAATTGAGCAAGG + Intergenic
931293049 2:60893717-60893739 CAGCATACCACAAAGGAGCAAGG - Intronic
932634195 2:73373605-73373627 TAGCAACAGCCAAAGGAGCAAGG - Intergenic
934533111 2:95108325-95108347 GACCATTGCCCAAAGAAGCAAGG - Exonic
935264230 2:101381093-101381115 CAGCATCTCCCACAGGAGCGGGG - Intronic
936268849 2:111032976-111032998 GAGGCTCACCCAAAGGTGCAAGG - Intronic
940121602 2:150274146-150274168 CAGCATCACACTAAGGAGCAGGG - Intergenic
941073243 2:160978438-160978460 GAGCATCACACCAAGGAGCCAGG - Intergenic
945061231 2:205910604-205910626 GTGCACCCCACAAAGGAGCTTGG - Intergenic
1169267377 20:4174854-4174876 GAGCCACCTCCAAAGGGGCAGGG - Intronic
1169909233 20:10633808-10633830 GAACAGCCTACAAAGGAGCAGGG + Intronic
1172482072 20:35277230-35277252 GAGCAGCCCCCCCAGGAGTATGG + Intergenic
1175508387 20:59503798-59503820 CAGCATACCCCCAAGAAGCATGG - Intergenic
1175852671 20:62102114-62102136 GGGGATGCCCCAGAGGAGCAAGG + Intergenic
1176768977 21:13052513-13052535 GACCCTCCCCCAGAGGAGAATGG - Intergenic
1178137055 21:29639455-29639477 AAGCATGACCCAGAGGAGCACGG + Intronic
1179986888 21:44927184-44927206 GAGGAGACCCCATAGGAGCAGGG + Intronic
1180433533 22:15278672-15278694 GACCCTCCCCCAGAGGAGAATGG - Intergenic
1180516092 22:16146581-16146603 GACCCTCCCCCAGAGGAGAATGG - Intergenic
1181062471 22:20288210-20288232 AGACATCCCCCAAAAGAGCAAGG - Intergenic
1184123889 22:42472973-42472995 CAGCATCTCAGAAAGGAGCAGGG + Intergenic
950672539 3:14535876-14535898 GAGGAACGCCCAAAGGAGCTGGG - Intronic
951642938 3:24856217-24856239 GACCTTCCCCCAAATGAGCCAGG + Intergenic
953642561 3:44722904-44722926 GAGCCTCCCCCATGGTAGCATGG - Exonic
953879708 3:46685342-46685364 GAGCTGTCCCCAGAGGAGCATGG - Intronic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
955498312 3:59559778-59559800 GAGCCTGTCCCAAATGAGCATGG + Intergenic
957452131 3:80392928-80392950 AAGCATCCCACAAGGGAGAAAGG + Intergenic
961558241 3:127711291-127711313 GACCCTCCCCCAGAGGACCACGG + Intronic
962935107 3:140073584-140073606 AAGCATCTCCCAATGGACCAAGG + Intronic
963066996 3:141271903-141271925 GAGCTGCTCCCAAAGGAGGATGG + Intronic
965075571 3:163970973-163970995 GAGCATGGGCCAAGGGAGCAGGG + Intergenic
968090394 3:195895411-195895433 GAGCATCCTCCAGAAGTGCAGGG + Exonic
972209964 4:36824450-36824472 GGGCATCTCCCATAGGAGCTTGG + Intergenic
983233251 4:165150713-165150735 GAGCATCAGCCAAAGCAGGAGGG - Intronic
986209927 5:5662154-5662176 GGCCATCCCAGAAAGGAGCAAGG - Intergenic
987274769 5:16350784-16350806 AAGCAGCCCCCAAATGAGAAAGG + Intergenic
991052128 5:62284539-62284561 GTGAATGACCCAAAGGAGCAAGG - Intergenic
992334653 5:75753282-75753304 GTTCATACCCCCAAGGAGCAGGG - Intergenic
996777016 5:127143449-127143471 GACCATTGCCCAAAGAAGCAAGG - Intergenic
1004533180 6:16473668-16473690 CAGGATCCCACAAAGGAGCGAGG + Intronic
1005697577 6:28365470-28365492 GAGCTTCCAGAAAAGGAGCATGG + Exonic
1007884503 6:45211029-45211051 GACCATTCCACAAAGGAGCATGG + Intronic
1017785961 6:157757485-157757507 GCTCATCCTCCAAAAGAGCATGG + Intronic
1018068007 6:160137184-160137206 CAGCATCCTCCTAGGGAGCAGGG - Intronic
1019406535 7:887042-887064 GGGCATCTCCCAGAGCAGCAGGG - Intronic
1019611003 7:1936607-1936629 GAGGCTGCCCCAAAGGCGCACGG + Intronic
1021688680 7:23211771-23211793 GAGCAGCCTCCAGAGGAGAATGG - Intergenic
1022503812 7:30898373-30898395 GTGCTTCAGCCAAAGGAGCAAGG + Intergenic
1026942387 7:74294671-74294693 GAGCACCCCCAAAAGGAGCTAGG - Intronic
1033617074 7:143026878-143026900 GAGCAATCCCCAAAGCATCATGG + Exonic
1034290775 7:149929644-149929666 GAGCAGCCTCCAAAGCAGCTGGG + Intergenic
1034660297 7:152763198-152763220 GAGCAGCCTCCAAAGCAGCTGGG - Intronic
1037571713 8:20163567-20163589 GAGCATCCCTCAAAGGTGTTGGG - Intronic
1040561048 8:48523819-48523841 CAGCATCCCCCAGAGGAGGTGGG - Intergenic
1041348912 8:56929477-56929499 TAGCATCCCACAGAAGAGCAAGG + Intergenic
1044618180 8:94163504-94163526 GAGCATCCCCCAAAGGAGCAAGG - Intronic
1044873153 8:96639909-96639931 GAGCATGCCTCCTAGGAGCAAGG + Intergenic
1048875103 8:138830891-138830913 GTGCACCCCCCACATGAGCATGG + Intronic
1049186024 8:141254065-141254087 GTGCATCACCCACAGGCGCATGG + Intronic
1051437087 9:17044404-17044426 GAGATTTCCCCAATGGAGCAGGG + Intergenic
1053706220 9:40754765-40754787 GACCCTCCCCCAGAGGAGAATGG + Intergenic
1054416296 9:64878370-64878392 GACCCTCCCCCAGAGGAGAATGG + Intergenic
1056842041 9:90005590-90005612 GAGCAACCCACAGAGGAGCCTGG + Intergenic
1057183196 9:93040715-93040737 GAGCTTCCCACCTAGGAGCAGGG - Intergenic
1057183249 9:93040974-93040996 GAGGAGGCCCCAAGGGAGCAAGG - Intergenic
1058997857 9:110317426-110317448 GAGCATCCCCAAAAGGAGAGAGG - Intronic
1062138023 9:134939947-134939969 GGGCATCCACCACAGGAGGATGG + Intergenic
1185493355 X:536274-536296 GAGCCTCCCCCACAGGGGCTGGG - Intergenic
1190791558 X:53705466-53705488 GAGCCTGCTCCAAAGGAGAAAGG + Intergenic
1192229775 X:69256892-69256914 GAGCATCCCTAAATGAAGCAGGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198286181 X:135194386-135194408 GAGCAGGGCCCACAGGAGCAGGG - Intergenic
1198286186 X:135194401-135194423 GAGCAGGGCCCACAGGAGCAGGG - Intergenic
1200090613 X:153634220-153634242 GGGTGTCCCCCAAAGGAGGAGGG - Intergenic