ID: 1044621049

View in Genome Browser
Species Human (GRCh38)
Location 8:94191011-94191033
Sequence CTTCCTCCCACCACAGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044621040_1044621049 22 Left 1044621040 8:94190966-94190988 CCTTAGATTTGCTGCCCCTGGGC 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data
1044621044_1044621049 0 Left 1044621044 8:94190988-94191010 CCACTGCCAAGCCCTCTCCTTTT 0: 1
1: 0
2: 2
3: 43
4: 517
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data
1044621041_1044621049 8 Left 1044621041 8:94190980-94191002 CCCCTGGGCCACTGCCAAGCCCT 0: 1
1: 0
2: 5
3: 32
4: 344
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data
1044621043_1044621049 6 Left 1044621043 8:94190982-94191004 CCTGGGCCACTGCCAAGCCCTCT 0: 1
1: 1
2: 5
3: 48
4: 408
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data
1044621042_1044621049 7 Left 1044621042 8:94190981-94191003 CCCTGGGCCACTGCCAAGCCCTC 0: 1
1: 0
2: 3
3: 43
4: 353
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data
1044621045_1044621049 -6 Left 1044621045 8:94190994-94191016 CCAAGCCCTCTCCTTTTCTTCCT 0: 1
1: 2
2: 12
3: 174
4: 1541
Right 1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044621049 Original CRISPR CTTCCTCCCACCACAGAGAC CGG Intronic
No off target data available for this crispr