ID: 1044624070

View in Genome Browser
Species Human (GRCh38)
Location 8:94218858-94218880
Sequence GAACCCTGTTTGTCTAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044624065_1044624070 27 Left 1044624065 8:94218808-94218830 CCAAGGAAGTAAAAACTAAGGTG No data
Right 1044624070 8:94218858-94218880 GAACCCTGTTTGTCTAAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044624070 Original CRISPR GAACCCTGTTTGTCTAAAAA CGG Intergenic
No off target data available for this crispr