ID: 1044624231

View in Genome Browser
Species Human (GRCh38)
Location 8:94220518-94220540
Sequence TGCCAGAATCAAAATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044624229_1044624231 -6 Left 1044624229 8:94220501-94220523 CCTAACAATTGTGAAATTGCCAG No data
Right 1044624231 8:94220518-94220540 TGCCAGAATCAAAATGGAGTTGG No data
1044624228_1044624231 9 Left 1044624228 8:94220486-94220508 CCAATTCTAGATTCACCTAACAA No data
Right 1044624231 8:94220518-94220540 TGCCAGAATCAAAATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044624231 Original CRISPR TGCCAGAATCAAAATGGAGT TGG Intergenic
No off target data available for this crispr