ID: 1044624646

View in Genome Browser
Species Human (GRCh38)
Location 8:94225351-94225373
Sequence CAAGCAAATAAATGAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044624644_1044624646 18 Left 1044624644 8:94225310-94225332 CCAAACGATTCCTTCATTTTCTG No data
Right 1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG No data
1044624645_1044624646 8 Left 1044624645 8:94225320-94225342 CCTTCATTTTCTGCTTTTAATTT No data
Right 1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044624646 Original CRISPR CAAGCAAATAAATGAAAAGC AGG Intergenic
No off target data available for this crispr