ID: 1044626330

View in Genome Browser
Species Human (GRCh38)
Location 8:94237595-94237617
Sequence AACCCTCAGCTGCATCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044626330_1044626332 -8 Left 1044626330 8:94237595-94237617 CCTGTGAGATGCAGCTGAGGGTT No data
Right 1044626332 8:94237610-94237632 TGAGGGTTTTATGGACAAACAGG No data
1044626330_1044626333 23 Left 1044626330 8:94237595-94237617 CCTGTGAGATGCAGCTGAGGGTT No data
Right 1044626333 8:94237641-94237663 ATGCTGCACACTATACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044626330 Original CRISPR AACCCTCAGCTGCATCTCAC AGG (reversed) Intergenic
No off target data available for this crispr