ID: 1044628034

View in Genome Browser
Species Human (GRCh38)
Location 8:94253799-94253821
Sequence TGAACACAGTACAGTACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044628027_1044628034 13 Left 1044628027 8:94253763-94253785 CCTGCACTTGAGCCCAGATCTTG 0: 1
1: 0
2: 0
3: 27
4: 282
Right 1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG No data
1044628029_1044628034 1 Left 1044628029 8:94253775-94253797 CCCAGATCTTGTGTAGGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG No data
1044628031_1044628034 0 Left 1044628031 8:94253776-94253798 CCAGATCTTGTGTAGGTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG No data
1044628025_1044628034 17 Left 1044628025 8:94253759-94253781 CCTCCCTGCACTTGAGCCCAGAT 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG No data
1044628026_1044628034 14 Left 1044628026 8:94253762-94253784 CCCTGCACTTGAGCCCAGATCTT 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1044628034 8:94253799-94253821 TGAACACAGTACAGTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044628034 Original CRISPR TGAACACAGTACAGTACAAT GGG Intronic
No off target data available for this crispr