ID: 1044634299

View in Genome Browser
Species Human (GRCh38)
Location 8:94307252-94307274
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044634299_1044634303 17 Left 1044634299 8:94307252-94307274 CCCGCTTTCTAGATGGACACTGC No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044634299 Original CRISPR GCAGTGTCCATCTAGAAAGC GGG (reversed) Intergenic
No off target data available for this crispr