ID: 1044634303

View in Genome Browser
Species Human (GRCh38)
Location 8:94307292-94307314
Sequence TCTCATTTACTGTAGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044634295_1044634303 24 Left 1044634295 8:94307245-94307267 CCCTCACCCCGCTTTCTAGATGG No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data
1044634300_1044634303 16 Left 1044634300 8:94307253-94307275 CCGCTTTCTAGATGGACACTGCA No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data
1044634298_1044634303 18 Left 1044634298 8:94307251-94307273 CCCCGCTTTCTAGATGGACACTG No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data
1044634299_1044634303 17 Left 1044634299 8:94307252-94307274 CCCGCTTTCTAGATGGACACTGC No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data
1044634297_1044634303 23 Left 1044634297 8:94307246-94307268 CCTCACCCCGCTTTCTAGATGGA No data
Right 1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044634303 Original CRISPR TCTCATTTACTGTAGCTGAG AGG Intergenic
No off target data available for this crispr