ID: 1044635549

View in Genome Browser
Species Human (GRCh38)
Location 8:94320193-94320215
Sequence GTGATTGCAGGACTTTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 2, 1: 0, 2: 13, 3: 100, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044635549_1044635556 27 Left 1044635549 8:94320193-94320215 CCAATGAAAAGTCCTGCAATCAC 0: 2
1: 0
2: 13
3: 100
4: 285
Right 1044635556 8:94320243-94320265 ATTCTCTCTCCATGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044635549 Original CRISPR GTGATTGCAGGACTTTTCAT TGG (reversed) Intergenic
904797887 1:33071099-33071121 GTCATTGCAGGGTTTTTAATAGG + Intronic
906827171 1:48993792-48993814 GTGATTGTGGGACTTTGTATTGG - Intronic
906915380 1:50004144-50004166 GTGATTGTGGGACTTTTCATTGG + Intronic
908175704 1:61553140-61553162 CTGATTGTGGGACTTTGCATTGG - Intergenic
908397693 1:63741200-63741222 GTGATTGTGGAACTTTGCATTGG - Intergenic
909320570 1:74280536-74280558 GTGATTGTCAGACTTTGCATTGG + Intronic
909582463 1:77253479-77253501 GTGATTGTGGGACTTTGCATTGG + Intergenic
909870363 1:80731143-80731165 GTGATTGTGGGACTTTGCATTGG + Intergenic
910102607 1:83594533-83594555 GTAATTGTAGGACTTTGTATTGG - Intergenic
910384226 1:86664362-86664384 GTGATTACAGGATTTTGCACTGG + Intergenic
910384429 1:86665558-86665580 GTGATTACAGGATTTTGCACTGG - Intergenic
910470524 1:87547733-87547755 GTGACTGTGGGACTTTGCATTGG - Intergenic
910724846 1:90327805-90327827 GTGATTGTGGGACTTTGCATTGG + Intergenic
911012599 1:93297045-93297067 GTGATTTTGGGACTTTGCATTGG - Intergenic
911239519 1:95449682-95449704 GTGCTTGTGGGACTTTGCATTGG - Intergenic
911336494 1:96587245-96587267 GCGACAGCATGACTTTTCATTGG - Intergenic
912633374 1:111268291-111268313 GTGATTGTAGGACTTTGCACTGG - Intergenic
912643822 1:111372287-111372309 GTGATTGTGGGACTTTGCACTGG + Intergenic
913964476 1:143364083-143364105 GCGATTGCATTACTTTTCAGAGG + Intergenic
914058845 1:144189689-144189711 GCGATTGCATTACTTTTCAGAGG + Intergenic
914120304 1:144776682-144776704 GCGATTGCATTACTTTTCAGAGG - Intergenic
915752663 1:158226773-158226795 GTGATTGTGGGACTTCACATTGG + Intergenic
915803626 1:158820693-158820715 GTAATTGCAGGACTTCTGAAGGG - Intergenic
916224391 1:162475105-162475127 CTGATTGTGGGACTTTGCATTGG + Intergenic
916690926 1:167189563-167189585 GTGATTACAGGACTTTCTAAGGG + Intergenic
916993290 1:170267862-170267884 GTGATTGTTGTACTTTGCATTGG - Intergenic
917397036 1:174604334-174604356 GTGATTGTGGGACTTTGCTTTGG - Intronic
917581559 1:176383732-176383754 TTGATTGTGGGTCTTTTCATAGG + Intergenic
919552176 1:199005074-199005096 GTGATTGGAGAAGTTTTCCTGGG + Intergenic
920361215 1:205417730-205417752 GGGATTACAGGATTTTTCAGAGG + Intronic
921002147 1:211055269-211055291 GTGATTGTGGGACTTTGCATTGG + Intronic
921009365 1:211125741-211125763 GTGATTGCAGAACATTTAAAAGG + Intronic
921774668 1:219082772-219082794 GTGATTGTGGGACTTTGCATTGG - Intergenic
922829118 1:228542154-228542176 GTGATTCCAGGCATTTTAATGGG - Intergenic
922830482 1:228550872-228550894 GTGACTTCAGGAGTTTTAATGGG - Intergenic
923980682 1:239319453-239319475 TTGATTGCAGGACTTTGAGTGGG - Intergenic
924481582 1:244439942-244439964 GTGATCATAGGACTTTGCATTGG - Intronic
924490925 1:244536550-244536572 GTGATTGTGGGACTTTCCGTCGG - Intronic
924516318 1:244768999-244769021 GTGACTGGGGGACTTTGCATTGG - Intergenic
1063479485 10:6361675-6361697 GTGAGTACAGGACTTTGCCTTGG - Intergenic
1065492579 10:26296770-26296792 CTGATTGGAGGACTTTTCAAAGG + Intronic
1067991331 10:51216083-51216105 GTGCTTGCAGGACTTGGTATAGG + Intronic
1068420619 10:56787201-56787223 TTGATTGCTTGAATTTTCATGGG - Intergenic
1070759992 10:79018218-79018240 GTAATTCCAGCACTTTGCATAGG - Intergenic
1071799547 10:89043337-89043359 ATGATTGTAGGACTTTGCATTGG - Intergenic
1071962550 10:90821342-90821364 GTGATTGTGGGACTTTGCATTGG + Intronic
1072492499 10:95921305-95921327 GTGATTGGGGGACTTTGCATTGG - Intronic
1075958142 10:126543057-126543079 GTGATTTAAGGAATTTTCAAGGG - Intronic
1076376710 10:129993158-129993180 GTGATTGTGGGACTTTGAATTGG + Intergenic
1076672050 10:132127553-132127575 CTGCTTGCTAGACTTTTCATCGG + Intronic
1077911880 11:6579607-6579629 GTGATTGTGGGACTTTGCATTGG + Intronic
1078407947 11:11087618-11087640 GTGCTTGCAGCACTTTTAATTGG + Intergenic
1079473997 11:20808785-20808807 ATGATTGTGGGACTTTGCATTGG - Intronic
1080096880 11:28418787-28418809 GTGAATGTGGGACTTTGCATTGG + Intergenic
1080219702 11:29887101-29887123 GTGATGGCAGGAATTTTTAATGG + Intergenic
1080585308 11:33676351-33676373 GTGGTTGCCTGATTTTTCATTGG - Intergenic
1080966639 11:37220555-37220577 GTGATCGTGGGACTTTGCATTGG - Intergenic
1081245654 11:40763665-40763687 GTGATTGTGGGACTTTGTATCGG + Intronic
1083528934 11:63398615-63398637 GTGATTGTGGGACTTTGCATTGG - Intronic
1084763959 11:71295389-71295411 GTGATTGTGGGACTTTGCATTGG - Intergenic
1085147200 11:74212208-74212230 GTGATTGTGTGACTTTGCATTGG + Intronic
1085980405 11:81717879-81717901 GTGATTGTGGGACTTTGCATTGG + Intergenic
1086261617 11:84947007-84947029 GTGATGGCTGGACTTGGCATTGG - Intronic
1087824496 11:102749552-102749574 GTGATTGTGAGACTTTGCATTGG - Intergenic
1088181706 11:107120769-107120791 GTGATTGTGGAACTTTCCATTGG + Intergenic
1088567888 11:111192193-111192215 GCCATTGTAGGACTATTCATTGG - Intergenic
1088814684 11:113412968-113412990 GTGTTTGCAGGAGTCTTCAGAGG - Intronic
1089406935 11:118205414-118205436 GTGATGGAGGGAATTTTCATGGG - Intronic
1090714123 11:129415166-129415188 CTGATTACAGGACCTATCATAGG - Intronic
1091191457 11:133698848-133698870 GTGATTGCAGGAGGTGTCAGTGG + Intergenic
1091388578 12:111089-111111 GGGATCCCAGGGCTTTTCATTGG + Intronic
1094757449 12:33489133-33489155 GTGATTGTGAGACTTTGCATTGG + Intergenic
1095860142 12:46907814-46907836 GTGACTGTGGGACTTTGCATTGG + Intergenic
1097426139 12:59446695-59446717 GTGATTCTGGGACTTTGCATTGG - Intergenic
1097801050 12:63914582-63914604 GTGATACAAGGACTTTTTATTGG - Intronic
1098060202 12:66553762-66553784 GTGATTTTGGGACTTTGCATTGG + Intronic
1098582864 12:72121508-72121530 GTGATTGCGGTACTTTGCATTGG - Intronic
1099002931 12:77202219-77202241 GTGATTGCATCTCTTTTCTTTGG - Intergenic
1099024396 12:77447614-77447636 GCAATTGCAGGACTTTGCATTGG + Intergenic
1099162011 12:79253576-79253598 GTCATTGCAGGATTATTAATTGG - Intronic
1099218364 12:79881142-79881164 GTGATTGTAGGGTTATTCATTGG - Intronic
1099491307 12:83292072-83292094 GTGATTGTGGGGCTTTGCATTGG + Intergenic
1099523214 12:83689435-83689457 GTGATTGTGGGACTTTGTATTGG + Intergenic
1099757784 12:86876879-86876901 GTGACTGTGGGACTTTGCATTGG - Intergenic
1104408922 12:128541986-128542008 GTGATGCCAGGACTTCACATTGG - Intronic
1105376314 13:19848400-19848422 GTAATTGCAGCACTTTTCGTAGG - Intronic
1106074657 13:26447918-26447940 GTGATTACGGGGCTTTGCATTGG + Intergenic
1108857933 13:54819283-54819305 GTGATTGTAAGACTTGACATTGG + Intergenic
1109049002 13:57453672-57453694 TTGTTTGCAGCACTTGTCATTGG - Intergenic
1109300735 13:60587405-60587427 GTGAATGCAGGGATTTTTATGGG - Intergenic
1109747533 13:66646910-66646932 GTGATTGTGAGACTTTGCATTGG + Intronic
1109961759 13:69640012-69640034 ATGATTGCGGGACTTTGCGTTGG - Intergenic
1110691011 13:78429708-78429730 GGGATTCCAGGGCTTTTCACTGG + Intergenic
1111335460 13:86815777-86815799 GTGATTGTGGGACCTTGCATTGG + Intergenic
1111895502 13:94136762-94136784 GTGATTGAAGGAATTTTAAAAGG + Intronic
1113217497 13:108060174-108060196 GTGATTGTAGGACTTCACACTGG + Intergenic
1113390603 13:109892886-109892908 GTGATGGTTGGAATTTTCATGGG + Intergenic
1113661480 13:112108967-112108989 TTGGTGGCAGGACTTCTCATGGG + Intergenic
1114071206 14:19108894-19108916 ATGCTTCCAGGACTTTTCAGTGG - Intergenic
1114091057 14:19291081-19291103 ATGCTTCCAGGACTTTTCAGTGG + Intergenic
1115660886 14:35493613-35493635 GTGATTGTGGGACTTTGCATTGG + Intergenic
1116114877 14:40635401-40635423 GTGATTGTGGGACTTCACATTGG + Intergenic
1116354701 14:43914021-43914043 GTGATTGTGGGACTTTGCACTGG + Intergenic
1116392727 14:44413055-44413077 GTGATTGTGAGACTTTGCATTGG + Intergenic
1116413092 14:44648992-44649014 GTGATTATGGGACTTTGCATTGG + Intergenic
1116583588 14:46674311-46674333 GTGATTGAAGGATTTTGCATGGG + Intergenic
1117208571 14:53470811-53470833 GTGATTGTGGGACTTTGCATTGG - Intergenic
1117504545 14:56389097-56389119 GCGATTGTGGGACTTTGCATTGG - Intergenic
1117607104 14:57440947-57440969 GTGATTGTGGGGCTTTTCAGGGG - Intergenic
1117843142 14:59881496-59881518 GTGATTGTGGAACTTTGCATTGG - Intergenic
1118034281 14:61849611-61849633 GTGATTGTGGGACTTTGCATTGG - Intergenic
1118112391 14:62736138-62736160 GTTGTTGCAAGACTTTTCACTGG + Intronic
1118431283 14:65720937-65720959 GTGATTGTGGGACTTTGCACTGG - Intronic
1120107857 14:80516732-80516754 GTGATTGTGGAACTTTGCATGGG - Intronic
1120426068 14:84350304-84350326 GTGATTGTAGGACTTTGCATTGG + Intergenic
1123208769 14:106738749-106738771 GTGTTGGAAGCACTTTTCATTGG - Intergenic
1126217480 15:46173008-46173030 GTGACTGCGGGACTTTTGATGGG - Intergenic
1126285905 15:47010012-47010034 GTGATTGTAGAATTTTGCATTGG - Intergenic
1126538209 15:49792076-49792098 GTAACTGCAGGACTTTTCTATGG - Intergenic
1126572284 15:50164891-50164913 GTGATTGTAGGACTTTGCATTGG - Intronic
1126660828 15:51031458-51031480 GTGATTGTGGGACTTTGCATTGG - Intergenic
1126979947 15:54229144-54229166 GTAATTGCAGGACTTTGCGTTGG - Intronic
1127140271 15:55969141-55969163 GTGATTGTGGGACTTTGCATTGG + Intronic
1127170780 15:56299239-56299261 GTGGTTGTAGAACTTTGCATTGG + Intronic
1127173368 15:56327708-56327730 GCGATTGCAGAACTTTGCATTGG + Intronic
1127239499 15:57097153-57097175 GAGATTTCAGAATTTTTCATAGG - Intronic
1131944801 15:97608409-97608431 GTGATTGTGGGACTTTGCATTGG + Intergenic
1132814824 16:1820710-1820732 GTGGTTGCTGGAGTCTTCATGGG - Intronic
1133999204 16:10769658-10769680 GTGATTCAAGGACTCTTCAAGGG - Intronic
1134407163 16:13970573-13970595 GTGATTGCAGGACCTCGCATTGG - Intergenic
1137051105 16:35713788-35713810 GTGGTTCCAGGCCTTTTAATTGG - Intergenic
1138092124 16:54183333-54183355 GTGAATGCATGACTTTCCAATGG + Intergenic
1140446524 16:75033282-75033304 ATGCTTGCAGGAATTTTGATTGG + Intronic
1140972470 16:80027068-80027090 GAGATTCCAGGACTTGTCTTTGG + Intergenic
1143413586 17:6728441-6728463 GTGATTGTGGGACTTTGCATCGG + Intergenic
1148392552 17:47283316-47283338 CTGATTGCTGGACTTCTCTTTGG + Intronic
1149249344 17:54750021-54750043 GTGATTGTGGGACTTTGCATTGG - Intergenic
1150181044 17:63121461-63121483 GTGATTTTTGGACTTTTCTTTGG + Intronic
1150870898 17:68910333-68910355 GTCATTGTGGGACTTTGCATTGG + Intronic
1153183420 18:2460722-2460744 GTGATTGTGAGACTTTGCATTGG - Intergenic
1153938520 18:9954161-9954183 GTAATTGCAGCCATTTTCATTGG + Exonic
1154234892 18:12595503-12595525 GAGATTACAGAACTTTTCATAGG + Intronic
1155234867 18:23809274-23809296 GTGATTGCAGGGCTGTTAAGTGG + Intronic
1155792758 18:29995483-29995505 GTGACTGTGGGACTTTGCATTGG + Intergenic
1156055488 18:32998179-32998201 GTGATTGTGGGACTTTGCGTTGG + Intronic
1156703273 18:39850178-39850200 GTGGGTGCATGACTGTTCATTGG - Intergenic
1157006400 18:43589552-43589574 CTGAGTCCAGGGCTTTTCATGGG + Intergenic
1157879198 18:51304125-51304147 GTGATTGTGGGACTTTGCACTGG + Intergenic
1157936865 18:51883247-51883269 GTGATTGTGAGACTTTGCATTGG + Intergenic
1158606881 18:58903395-58903417 GTGATTCCAGGATTTTTAATAGG + Intronic
1159285041 18:66337542-66337564 GTGACTGTGGGACTTTGCATTGG - Intergenic
1159647961 18:70942482-70942504 GTGATTGTGGGACTTTGCATTGG + Intergenic
1162304205 19:9861687-9861709 GTTACTGCAGGACTTATCAGAGG + Intronic
1162596031 19:11629999-11630021 GTGATTGTGGCACTTTGCATTGG + Intergenic
1164383238 19:27752909-27752931 GTGACTGCAGGAATTCTAATGGG - Intergenic
1164721125 19:30432313-30432335 GGGCTTGGAGGACTTTCCATAGG + Intronic
1165369558 19:35396062-35396084 GTGAGTACAGGACTTGTCCTTGG - Intergenic
1165645269 19:37430897-37430919 GTGATTGCAGGACTTTTCATTGG + Intronic
1167398806 19:49251031-49251053 GTGAGTGGAAGAGTTTTCATAGG - Intergenic
1202698248 1_KI270712v1_random:141574-141596 GTGATTGCATTACTTTTCAGAGG + Intergenic
925699058 2:6614358-6614380 GTGAGTGTGGGACTTTGCATTGG - Intergenic
926516251 2:13850657-13850679 GTAATTGTGGGACTTTGCATTGG + Intergenic
926518751 2:13883424-13883446 GTGATTGCGGGTCTTTGCATTGG + Intergenic
927358471 2:22203773-22203795 GTGACTGCTGGAATTTTGATAGG - Intergenic
927782472 2:25950783-25950805 GTGAATAGAGGACTTTTCAATGG - Intronic
928483957 2:31711004-31711026 GTGATTGTGGGACTTTGCATTGG + Intergenic
929676069 2:43931137-43931159 GTGATTGCAGAACTACTCAAAGG - Intronic
930230817 2:48842029-48842051 GTGATTGTGAGACTTTGCATTGG - Intergenic
930288942 2:49468757-49468779 GTGATTGTGGGACTTTGCATTGG - Intergenic
930971401 2:57398787-57398809 GTGATTGTGGGACTTTGCATTGG - Intergenic
930981270 2:57528767-57528789 GTGATTGTGGGACTTTTCATTGG - Intergenic
932889380 2:75579015-75579037 GTGATTGTGGGACTTTGCATTGG + Intergenic
933406125 2:81862090-81862112 GTGACTCCAGGACTTTTCCTTGG - Intergenic
934279500 2:91599357-91599379 GCGATTGCATTACTTTTCAGAGG + Intergenic
934928863 2:98404057-98404079 GTGATTGTGGGACTTTGCATTGG + Intergenic
936511402 2:113150394-113150416 GTGATTGCCGGACTTTGTATTGG - Intergenic
937372230 2:121306872-121306894 GTGTTCCCAGGTCTTTTCATAGG - Intergenic
937739365 2:125332637-125332659 GTGGTTGTAGAACCTTTCATTGG + Intergenic
938080076 2:128365184-128365206 GTGAGCGCAGGTCTCTTCATAGG + Intergenic
939144424 2:138395715-138395737 GTGACTGTGGGACTTTTCCTTGG + Intergenic
939556181 2:143676519-143676541 GTCATTGTAGGTTTTTTCATTGG + Intronic
940559958 2:155282262-155282284 GTGATTATGGGACTTTGCATTGG - Intergenic
941138576 2:161747350-161747372 GTGATTGTGGGACTTTGCATTGG - Intronic
941746093 2:169088280-169088302 GTGATTGTGGGACTTTGCATTGG - Intronic
941851924 2:170191620-170191642 GTGATTGGGGAACTTTGCATTGG - Intronic
943302616 2:186223012-186223034 GTGATTGTGAGACTTTGCATTGG + Intergenic
943697389 2:190950896-190950918 TTGCTTCCAGGACTTTTAATGGG - Intronic
944616547 2:201465897-201465919 GTGATTGTGGGACTTTGCACTGG - Intronic
944855208 2:203760502-203760524 GTGATTGCAGGACTTTACGTTGG - Intergenic
945804695 2:214476404-214476426 GTAATTGCAGAAATATTCATTGG + Intronic
946030729 2:216702436-216702458 GTAATTTAAGGACTTTTCATGGG - Intergenic
948475615 2:238217104-238217126 GTGATTGTGGGACTTTGCACTGG - Intergenic
948774556 2:240277093-240277115 GTGACTGTGGGACTTTGCATTGG + Intergenic
1170802634 20:19603053-19603075 GTGATTTCAGGACTTTAAACAGG - Intronic
1171334038 20:24367261-24367283 CTGGTTGCAGAAGTTTTCATAGG - Intergenic
1171942788 20:31347945-31347967 GTGATTGTGGGACTTTGCATTGG + Intergenic
1172482362 20:35278293-35278315 GAGGTTGCAGGTCTTTTCCTGGG - Intergenic
1174407540 20:50311932-50311954 CAGATTCCAGTACTTTTCATTGG - Intergenic
1174690933 20:52503825-52503847 GTGACTGTGGGACTTTGCATTGG + Intergenic
1175632273 20:60551195-60551217 GTGATTGTAGGACTTTATGTTGG - Intergenic
1176936064 21:14868318-14868340 GTGATTGCAAGTGTTTTCAAAGG - Intergenic
1177039498 21:16089859-16089881 ATGCTTGCTGAACTTTTCATTGG + Intergenic
1177539736 21:22477121-22477143 GTAATTGTAGGACTTGGCATTGG + Intergenic
1179363257 21:40732437-40732459 GTGATTTCATGACTCTTAATTGG - Intronic
1180489652 22:15831221-15831243 ATGCTTCCAGGACTTTTCAGTGG - Intergenic
1185005282 22:48272484-48272506 CTCATTGCAGGACTTTGCAGAGG - Intergenic
951129823 3:19029384-19029406 GTGATTGTGGGATGTTTCATTGG + Intergenic
951437094 3:22677176-22677198 GTGATTGTGGGACTTTGCATGGG - Intergenic
951465057 3:22991721-22991743 GTGATTGCAGGACTTGCCTGAGG - Intergenic
952174473 3:30846787-30846809 GTGATTGCAGGTCTTCTCCACGG - Intronic
952518012 3:34125125-34125147 ATGATTGCAGAACTTTGCATTGG - Intergenic
952812010 3:37412322-37412344 GTGATTGTGGGACTTTGCATTGG - Intronic
954002892 3:47571696-47571718 GTGACTGAAGGACTTTCCCTGGG - Intronic
957018975 3:75102102-75102124 GTGATTGTGGCACTTTGCATTGG - Intergenic
957485590 3:80858425-80858447 GTGATTGAGGGACTTAGCATTGG + Intergenic
957538097 3:81532008-81532030 GTGACTGTGGGACTTTGCATTGG - Intronic
957977088 3:87460590-87460612 GTAATTGTAGGACTTTGAATTGG + Intergenic
958067797 3:88566593-88566615 TTGTTTGTAGGTCTTTTCATGGG - Intergenic
958451032 3:94272760-94272782 GAGATTTCAGGACTCTCCATTGG - Intergenic
958516152 3:95118494-95118516 GTGATTGTATGATTTTTCTTTGG + Intergenic
958670521 3:97197964-97197986 GTGATTGTAGGACTTTGCAGTGG - Intronic
958760056 3:98296235-98296257 CTGATTGTGGGACTTTTCATTGG + Intergenic
959126058 3:102291313-102291335 GTGATTGTGGGACTTTGCATTGG - Intronic
959806709 3:110562843-110562865 GTGATTGTGGGACTTTGCTTTGG - Intergenic
959824460 3:110777441-110777463 GCTATTGCAGGACTTTTCCCTGG + Intergenic
959913840 3:111794285-111794307 GTGACTGCGGGACTTTGCATTGG - Intronic
960298187 3:115968987-115969009 GTGATTGTAGGTCTTTGCATTGG - Intronic
960404030 3:117238074-117238096 GTGATTGTGGGACTTTGCATTGG + Intergenic
961515119 3:127427490-127427512 GGGCTGGCAGGACTTTTCAGTGG - Intergenic
961969851 3:130950552-130950574 GTGATTGCAAGAGTTTTCCTAGG - Intronic
962638916 3:137362297-137362319 GTAATTGTGGGACTTTGCATTGG - Intergenic
962707414 3:138058396-138058418 GTTTTGGCAGGACTCTTCATTGG - Intergenic
962997977 3:140650732-140650754 GTGATTGTGGGATTTTGCATTGG + Intergenic
963020593 3:140869448-140869470 GTGATTGTGAGACTTTGCATTGG - Intergenic
963528850 3:146447973-146447995 GTGATTGTGGGACTTTGCATTGG - Intronic
963883459 3:150553898-150553920 CTGCTTCCAGGCCTTTTCATTGG - Intronic
964686665 3:159403499-159403521 GTGATTGAGGGACTTCGCATTGG + Intronic
965980186 3:174681043-174681065 CTAATTGCAAGACTTTGCATTGG + Intronic
966454106 3:180095047-180095069 GTGATTGTGGGATTTTGCATTGG - Intergenic
967697060 3:192544165-192544187 GTGATTGTGGGACTTTGCATTGG - Intronic
969031253 4:4216534-4216556 GCGATTGCATTACTTTTCAGAGG - Intronic
970098077 4:12487437-12487459 GTGATTGTGAGACTTTGCATTGG - Intergenic
972935688 4:44132096-44132118 GTGGTTGCTTGGCTTTTCATAGG - Intergenic
973214509 4:47654519-47654541 GTGATTGTGGGACTTTGCATTGG + Intronic
973348444 4:49082270-49082292 GTGATTGTGGGACTTTGCATTGG + Intergenic
973919937 4:55674314-55674336 GTGATTGTGGGACTTTTCATTGG - Intergenic
976762886 4:88569255-88569277 GGGATTGTGGGACTTTCCATTGG - Intronic
977307334 4:95341865-95341887 GTGATTGTGCGACTTTGCATTGG + Intronic
979111272 4:116761164-116761186 GTGATTGTGGGACTTTGCATTGG + Intergenic
979155944 4:117391471-117391493 GTGAATGCAAAACTTTTCATTGG + Intergenic
979945726 4:126829547-126829569 GTGATTGCGGGACTTTGCATTGG + Intergenic
980155968 4:129105873-129105895 GTGATTGCAGGAATTTAGGTAGG - Intronic
980177455 4:129364325-129364347 GTGAATGCGGGTCTTTTCCTGGG - Intergenic
980622097 4:135320783-135320805 GTGATTACGGGACCTTGCATTGG - Intergenic
980646582 4:135651343-135651365 GTGATTGTGGGACTTTGCATTGG + Intergenic
980682803 4:136186566-136186588 ATAATTGCAGGACTTCACATTGG + Intergenic
981286402 4:143024195-143024217 GTGATTGTGGGACTTTGCATTGG + Intergenic
982339724 4:154284601-154284623 GTGATTGTGGGACTCTGCATTGG + Intronic
982479037 4:155886390-155886412 GTGACTGCTGGCCTCTTCATGGG - Intronic
986181998 5:5401752-5401774 GTCAGGGCAGGACTTTTCACCGG - Intergenic
986631303 5:9776234-9776256 GTGACTACAGGACTTTGCATTGG - Intergenic
986885336 5:12226740-12226762 GTGATTGTGAGACTTTGCATTGG - Intergenic
987537290 5:19205980-19206002 GCGATTGCAGGACTTTACATTGG + Intergenic
988064580 5:26218361-26218383 GTGATGATAGGACTTTGCATTGG + Intergenic
988384076 5:30539167-30539189 GTGATTGCAGGACTTTGCACTGG + Intergenic
990400107 5:55429500-55429522 GGGATTGCAGGACTTCACAATGG - Intronic
993060169 5:83029498-83029520 GTGATTGTGGGACTTAGCATTGG + Intergenic
993097997 5:83503801-83503823 GTGATTGCAAGAATTGTCAGTGG + Intronic
993138254 5:83997840-83997862 GTGATTGTGGGACTGTGCATTGG + Intronic
993256986 5:85604483-85604505 GTGACGGTGGGACTTTTCATTGG + Intergenic
994292843 5:98050529-98050551 GTGATTGCAGGCTTTTGCATTGG + Intergenic
996653714 5:125913980-125914002 GTGATTGTGGGACTTTGCATTGG - Intergenic
996944910 5:129055420-129055442 GTGATTGTGAGACTTTGCATTGG + Intergenic
997104508 5:131003936-131003958 GTGATTGTGCGACTTTGCATTGG + Intergenic
1000433412 5:161179322-161179344 GTGATGGTGGGACTTTGCATTGG + Intergenic
1000539412 5:162521183-162521205 GTGATTGTGGCACTTTGCATTGG - Intergenic
1000814458 5:165903742-165903764 GTCATTCCAGGACTTTTGAAAGG + Intergenic
1000917486 5:167099930-167099952 GGCACTGCAGTACTTTTCATGGG + Intergenic
1002009884 5:176270681-176270703 GTGATTGTGAGACTTTGCATTGG + Intronic
1002216844 5:177641627-177641649 GTGATTGTGAGACTTTGCATCGG - Intergenic
1002911362 6:1493529-1493551 TTGATTGAGGGACTTTACATGGG - Intergenic
1007021744 6:38528129-38528151 GTGACTGTGGGACTTTGCATTGG + Intronic
1008101146 6:47392483-47392505 GTGACTGTGGGACTTTGCATTGG - Intergenic
1008238793 6:49083704-49083726 GTGATGGTGGGACTTTGCATTGG + Intergenic
1009847455 6:69151388-69151410 GTGATTGTGGGACTTTGCAATGG - Intronic
1010062271 6:71636466-71636488 GTGATTGTGGGACTTTGCATTGG - Intergenic
1011070722 6:83379738-83379760 GTGATTACAGAAATTATCATTGG - Intronic
1011340894 6:86313231-86313253 GCAATTGTAGGACTTTTCATTGG + Intergenic
1011359813 6:86511359-86511381 GTAATTGTGGGACTTTGCATTGG - Intergenic
1012059768 6:94463408-94463430 GTGATTGTGGGACTTTGCTTTGG - Intergenic
1012190673 6:96276392-96276414 GTGATTGTGAGACTTTGCATTGG + Intergenic
1012693170 6:102342293-102342315 GTGGATGCAGCACTTTTCACTGG - Intergenic
1012706190 6:102535179-102535201 TTGATTGCAAGACTTTTTGTTGG + Intergenic
1013908452 6:115245948-115245970 GCGATTGTGGGACTTTGCATGGG + Intergenic
1014342384 6:120226849-120226871 AGGATTGCAGGATTCTTCATTGG - Intergenic
1014794607 6:125710336-125710358 GGAATTGTGGGACTTTTCATTGG + Intergenic
1015392789 6:132701860-132701882 GTGATTGTGGGACTTTACATTGG + Intronic
1016054842 6:139567508-139567530 GTGATTGTGGGACTTTGCGTTGG - Intergenic
1016194521 6:141317564-141317586 GTGATTGTGTGACTTTGCATTGG + Intergenic
1019654398 7:2182250-2182272 ATGACTGCATGATTTTTCATTGG - Intronic
1020480451 7:8653763-8653785 GTGATAGGAGAACTTTTCAGAGG + Intronic
1020485505 7:8715218-8715240 GTGATTGTGGAACTTTGCATTGG - Intronic
1020574934 7:9913985-9914007 GTGATTGTGGGACTTTGCATTGG - Intergenic
1021214739 7:17901597-17901619 GTGATTATGGGACTTTGCATTGG - Intronic
1021884982 7:25129424-25129446 GTGATTGCAGGGCCTTGCATTGG - Intergenic
1021922979 7:25505725-25505747 ATGACTGTAGGACTTTGCATTGG + Intergenic
1023643508 7:42284859-42284881 GTGATTGGAAGAATTTTCATGGG - Intergenic
1023716137 7:43046315-43046337 GTGATTGTGGGACTTTGCTTTGG + Intergenic
1025061537 7:55812860-55812882 GTGATTGTGGGACTTTGCATTGG + Intronic
1027523956 7:79244463-79244485 GTGATTGTGGGACTTTGCATTGG + Intronic
1027602624 7:80257970-80257992 GTAATTGCTGGAATTTTAATTGG - Intergenic
1027604765 7:80287316-80287338 GTGATTGTAGGACTTTGCATTGG + Intergenic
1027753226 7:82178516-82178538 GGGATTGGAGGGGTTTTCATGGG - Intronic
1027826102 7:83118556-83118578 GTGATTGTAGGACCCTGCATTGG + Intronic
1028065921 7:86383743-86383765 GTGATTGCAAGAGTTTGAATAGG - Intergenic
1028353519 7:89879003-89879025 GTGATTATGGGACTTTTAATTGG - Intergenic
1028929663 7:96398402-96398424 GTGATTGTGGGACTTTGCATTGG - Intergenic
1028937201 7:96479320-96479342 GAGACTGGAGGACATTTCATGGG + Intergenic
1028972469 7:96874804-96874826 GTGATTGTGGGACTTTGCATTGG + Intergenic
1030391398 7:108932197-108932219 GTGATTGTGAGACTTTGCATTGG - Intergenic
1030665500 7:112273344-112273366 GTGATTGTGCGACTTTGCATTGG - Intronic
1031546389 7:123054997-123055019 GTGATTGTGGGACTTCTCATTGG - Intergenic
1031649820 7:124274889-124274911 TTCATTGCAGGACTTTGGATGGG + Intergenic
1031753666 7:125611471-125611493 GTGATTATGGGACTTTGCATTGG + Intergenic
1031893792 7:127324568-127324590 GTGATTGCACTACTTTGAATTGG + Intergenic
1033814119 7:145051636-145051658 GTGATTGTGGGACTTTACATCGG - Intergenic
1034126287 7:148674838-148674860 GTGATTGTGGGACTTTACATTGG + Intergenic
1034605060 7:152304921-152304943 GTGATAGCAGAAATTTTCCTTGG + Intronic
1034760869 7:153670501-153670523 GTGAATGCAGACCTATTCATAGG - Intergenic
1041606824 8:59792047-59792069 GTGATTATAGAACTTTCCATTGG + Intergenic
1043567204 8:81561651-81561673 GTGATTGTGGGACTTTGCATTGG + Intergenic
1044635549 8:94320193-94320215 GTGATTGCAGGACTTTTCATTGG - Intergenic
1045172657 8:99687622-99687644 GTGATTGTGGGACTTGGCATTGG - Intronic
1045717216 8:105062020-105062042 CTGATTTCAGGTCTTCTCATGGG - Intronic
1046215616 8:111141592-111141614 GTGATTATAGGACTTTGCATTGG - Intergenic
1046811541 8:118538546-118538568 GTGATTGTGGGACTTTACATTGG - Intronic
1047342931 8:124000163-124000185 GTGATTGTGGGATTTTGCATTGG - Intronic
1047389220 8:124436692-124436714 TAGAATGCAAGACTTTTCATGGG + Intergenic
1051039218 9:12785653-12785675 GTGATTATGGGACTTTGCATTGG - Intronic
1052396595 9:27946192-27946214 CTGTTTACAGGACTTTTCAGAGG + Intergenic
1052666340 9:31499862-31499884 GTGAGTACGGGACTTTGCATTGG + Intergenic
1053252665 9:36588020-36588042 GTAATTGCAGCACTTTTGAGAGG - Intronic
1054872173 9:70057774-70057796 GTGATTTAAAGACTTTTCCTTGG + Intronic
1056230692 9:84539716-84539738 GTGATTGTGGGACTTTGCATTGG - Intergenic
1056338704 9:85602865-85602887 GTGACTGTGGGACTTTGCATTGG + Intronic
1057084510 9:92196698-92196720 GTGAGTGTAGGACTTTGCATTGG + Intergenic
1058003833 9:99895025-99895047 GTGATTGTGAGACTTTGCATTGG + Intergenic
1058086283 9:100752016-100752038 GTGATTGTGGGACTTTGCATTGG - Intergenic
1058285362 9:103170053-103170075 GTGACTGTGGGACTTTGCATTGG - Intergenic
1058522917 9:105829430-105829452 CTGATTGCAGGACTTTGCATTGG - Intergenic
1058820774 9:108727691-108727713 GTGATTGCTGGACTTTGCATTGG + Intergenic
1059555599 9:115277119-115277141 GTGATTGTGGGACTTTGCACTGG - Intronic
1059838969 9:118191212-118191234 GTGATTGTGGGACTTCACATTGG + Intergenic
1060329766 9:122656451-122656473 GTTATTGCAGGAATTATCATGGG + Intergenic
1187132594 X:16517175-16517197 ATGATTGTGGGACTTTGCATTGG + Intergenic
1187723889 X:22182376-22182398 GTGATTGTGGGACTTTGCACTGG - Intronic
1188162000 X:26815400-26815422 GTGATTGTAGGACTTTGCGTTGG - Intergenic
1188421224 X:29992506-29992528 GTAATTGTGGGACTTTACATTGG - Intergenic
1189412002 X:40780584-40780606 GTGATGGTGGGACTTTGCATTGG - Intergenic
1189628052 X:42920749-42920771 GTGATCGTGGGACTTTTCATTGG + Intergenic
1189640651 X:43067461-43067483 GTGATTGTGGGACTTTGCATTGG + Intergenic
1189854518 X:45210200-45210222 GTGACTGTGGGACTTTGCATTGG - Intergenic
1190122596 X:47674537-47674559 GTGAATGTGGGACTTTGCATTGG - Intergenic
1190522901 X:51298447-51298469 GTGATTGTGAGACTTTGCATTGG + Intergenic
1191062807 X:56317898-56317920 GTGATCACAGGACTTTGCCTTGG + Intergenic
1191600116 X:62994101-62994123 GTGAGTGTGGGACTTTACATTGG - Intergenic
1191612063 X:63127570-63127592 GTGATTGTAAGACTTGGCATTGG + Intergenic
1192069529 X:67922556-67922578 GTGGTTGTGGGACTTTGCATTGG + Intergenic
1192677963 X:73219614-73219636 GTGAGTGTGGGACTTTGCATTGG + Intergenic
1193366830 X:80644343-80644365 GTGATTGTGAGACTTTGCATTGG - Intergenic
1193440953 X:81538659-81538681 GTGATTGTGGGACTTCACATTGG + Intergenic
1193750512 X:85337259-85337281 GTGAGTGTGGGACTTTGCATTGG - Intronic
1193896936 X:87126508-87126530 GTGATTATGGGACTTTGCATTGG + Intergenic
1193931695 X:87561383-87561405 GTGATTGTAGGACTTCACATTGG + Intronic
1194110119 X:89823813-89823835 GTGATTGTGAGACTTTGCATTGG + Intergenic
1194251594 X:91582378-91582400 TTTATTGCAGCACTATTCATGGG - Intergenic
1194507668 X:94752655-94752677 GTGATTGTGGAACTTTGCATTGG - Intergenic
1195037257 X:100981361-100981383 GTGATTGTAGGACTTTGGATTGG - Intronic
1195290154 X:103424416-103424438 GTGATTGTGGGACTTTGCATTGG - Intergenic
1195595332 X:106682717-106682739 GTGATTGTGGGACTTTGCATCGG + Intergenic
1195745278 X:108111298-108111320 ATGATTGGGGTACTTTTCATTGG + Intronic
1195948818 X:110245283-110245305 GTGAATGCAGGACATTTGAGGGG - Intronic
1196357469 X:114810547-114810569 GTGACTGTGGGACTTTGCATTGG - Intronic
1196368744 X:114951986-114952008 GTGATTGTGGGGCTTTGCATTGG + Intergenic
1196512189 X:116524579-116524601 ATGATTGGAGGACTTTGCATTGG - Intergenic
1197011479 X:121569986-121570008 ATGATTGTGGGACTTTGCATTGG + Intergenic
1197177966 X:123504792-123504814 GTGATTTGGGGACTTTTCATTGG + Intergenic
1197380932 X:125737519-125737541 TTGATTGTAGGACTTTGCATTGG - Intergenic
1197662973 X:129193789-129193811 TTTGTTGCAGGACTTTTCCTTGG - Intergenic
1197670701 X:129273786-129273808 GTGATTGTGGGACTTTACATTGG - Intergenic
1198947673 X:142032220-142032242 GTGATTGTAGGACTTTGTGTTGG - Intergenic
1199313962 X:146355169-146355191 GTGAATTCTGGACTTTTAATAGG - Intergenic
1199464454 X:148120327-148120349 GTGATTGTGGGACTTTGCACTGG + Intergenic
1199477639 X:148263104-148263126 GTGAGTGCAGGACTTTTTCTGGG - Intergenic
1199795397 X:151191076-151191098 GTGATTGCGGGACTTTGCATTGG + Intergenic
1199962821 X:152791785-152791807 GTGATTGTGGGACTTTGCGTTGG + Intergenic
1199989058 X:152974314-152974336 GTATTTGTAGGACTTTTAATTGG + Intergenic
1200462778 Y:3478554-3478576 GTGATTGTGAGACTTTGCATTGG + Intergenic
1200570531 Y:4823610-4823632 TTTATTGCAGCACTATTCATGGG - Intergenic
1201442174 Y:14020207-14020229 GGTATTGCAGGACATTTCTTTGG - Intergenic