ID: 1044635550

View in Genome Browser
Species Human (GRCh38)
Location 8:94320205-94320227
Sequence AGGGAGAGCACAGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044635550_1044635560 26 Left 1044635550 8:94320205-94320227 CCTGCAATCACTGTGCTCTCCCT No data
Right 1044635560 8:94320254-94320276 ATGCCACAGAGGCACTGCTGGGG No data
1044635550_1044635559 25 Left 1044635550 8:94320205-94320227 CCTGCAATCACTGTGCTCTCCCT No data
Right 1044635559 8:94320253-94320275 CATGCCACAGAGGCACTGCTGGG No data
1044635550_1044635558 24 Left 1044635550 8:94320205-94320227 CCTGCAATCACTGTGCTCTCCCT No data
Right 1044635558 8:94320252-94320274 CCATGCCACAGAGGCACTGCTGG No data
1044635550_1044635556 15 Left 1044635550 8:94320205-94320227 CCTGCAATCACTGTGCTCTCCCT No data
Right 1044635556 8:94320243-94320265 ATTCTCTCTCCATGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044635550 Original CRISPR AGGGAGAGCACAGTGATTGC AGG (reversed) Intergenic