ID: 1044635552

View in Genome Browser
Species Human (GRCh38)
Location 8:94320225-94320247
Sequence AGAATCTGTGTGCTCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044635552_1044635564 19 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635564 8:94320267-94320289 ACTGCTGGGGAATGAGGAATGGG No data
1044635552_1044635562 13 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635552_1044635560 6 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635560 8:94320254-94320276 ATGCCACAGAGGCACTGCTGGGG No data
1044635552_1044635556 -5 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635556 8:94320243-94320265 ATTCTCTCTCCATGCCACAGAGG No data
1044635552_1044635558 4 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635558 8:94320252-94320274 CCATGCCACAGAGGCACTGCTGG No data
1044635552_1044635565 22 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635565 8:94320270-94320292 GCTGGGGAATGAGGAATGGGTGG No data
1044635552_1044635559 5 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635559 8:94320253-94320275 CATGCCACAGAGGCACTGCTGGG No data
1044635552_1044635563 18 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635563 8:94320266-94320288 CACTGCTGGGGAATGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044635552 Original CRISPR AGAATCTGTGTGCTCAGGGG AGG (reversed) Intergenic
No off target data available for this crispr