ID: 1044635554

View in Genome Browser
Species Human (GRCh38)
Location 8:94320229-94320251
Sequence AGAGAGAATCTGTGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044635554_1044635559 1 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635559 8:94320253-94320275 CATGCCACAGAGGCACTGCTGGG No data
1044635554_1044635560 2 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635560 8:94320254-94320276 ATGCCACAGAGGCACTGCTGGGG No data
1044635554_1044635563 14 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635563 8:94320266-94320288 CACTGCTGGGGAATGAGGAATGG No data
1044635554_1044635562 9 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635554_1044635565 18 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635565 8:94320270-94320292 GCTGGGGAATGAGGAATGGGTGG No data
1044635554_1044635558 0 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635558 8:94320252-94320274 CCATGCCACAGAGGCACTGCTGG No data
1044635554_1044635564 15 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635564 8:94320267-94320289 ACTGCTGGGGAATGAGGAATGGG No data
1044635554_1044635556 -9 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635556 8:94320243-94320265 ATTCTCTCTCCATGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044635554 Original CRISPR AGAGAGAATCTGTGTGCTCA GGG (reversed) Intergenic