ID: 1044635562

View in Genome Browser
Species Human (GRCh38)
Location 8:94320261-94320283
Sequence AGAGGCACTGCTGGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044635554_1044635562 9 Left 1044635554 8:94320229-94320251 CCCTGAGCACACAGATTCTCTCT No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635552_1044635562 13 Left 1044635552 8:94320225-94320247 CCTCCCCTGAGCACACAGATTCT No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635553_1044635562 10 Left 1044635553 8:94320228-94320250 CCCCTGAGCACACAGATTCTCTC No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635555_1044635562 8 Left 1044635555 8:94320230-94320252 CCTGAGCACACAGATTCTCTCTC No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data
1044635551_1044635562 14 Left 1044635551 8:94320224-94320246 CCCTCCCCTGAGCACACAGATTC No data
Right 1044635562 8:94320261-94320283 AGAGGCACTGCTGGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044635562 Original CRISPR AGAGGCACTGCTGGGGAATG AGG Intergenic
No off target data available for this crispr